IJNR International Journal of Negative Results 2641-9181 Open Access Pub United States 10.14302/issn.2641-9181.ijnr-17-1778 IJNR-17-1778 letter Evidence for the Absence of La Crosse Virus, Rift Valley Fever Virus, and Bunyamwera Virus in Korean Domestic Pigs Hee-Chun Chung 1 Van-Giap Nguyen 2 Bong-Kyun Park 1 * Department of Veterinary Medicine Virology Laboratory, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, Korea. Department of Veterinary Microbiology and Infectious Diseases, Faculty of Veterinary Medicine, Vietnam National University of Agriculture, Hanoi 100000, Vietnam Corresponding author Huseyin Bekir YILDIZ 1 Professor Doctor in Department of Materials Science and Nanotechnology Engineering, KTO Karatay University, Konya, Turkey Bong Kyun Park, D.V.M., MSc, PhD, Department of Veterinary Medicine Virology Laboratory, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 151-742, Republic of Korea., Tel.: +82-2-880-1255, fax: +82-2-885-0263, e-mail address: parkx026@snu.ac.kr

The authors have declared that no competing interests exist.

 19 10 2017 1 1 1 4 18 09 2017 09 10 2017 19 10 2017 © 2017 Hee-Chun Chung, et al This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. This article is available from http://openaccesspub.org//ijnr/article/605

A surveillance study reports no detection of targeted bunyaviruses in domestic pigs in Korea. Methods, sampling frame, and assay limits are described to contextualize interpretation and surveillance value.

 LACV RVFV and BUNV Letter

Until today, several viruses of family Bunyaviridaesuch as severe fever thrombocytopenia syndrome virus (SFTSV), Rift Valley fever virus (RVFV), Sandfly fever Naples virus (SFNV), La Crosse virus (LACV), and Bunyamwera virus (BUNV) are known as zoonotic pathogens 123. An outbreak of RVFV (Phlebovirus) in developed countries including U.S and Europe, could force a curtailing of livestock movement to prevent RVFV spread, causing massive loss because of high rates mortality and abortion in pregnant sheep, cattle, and goat 4. Reported cases due to LACV and BUNV, members of the genus Orthobunyavirus, have been increased in North America, South America, Africa, and Europe 13. LACV, RVFV, and BUNV are transmitted by mosquitoes (Culex spp., Aedes spp., etc) which are known to prevail in Korea 5.

This study aimed to investigate the presence of LACV, RVFV, and BUNV in pigs in Korea, on the basic of regional and individual farm surveillance. From January to November, 2013, a total of 586 pig bloods were randomly collected from 45 commercial swine farms in 9 provinces (Supplementary Figure 1).

Total RNA of these samples was extracted using Trizol LS (Invitrogen, USA) following the

manufacturer’s instructions. The RNA was then converted into cDNA with the use of random hexamers and commercial M-MLV reverse transcriptase kit (Invitrogen, USA) following the manufacturer’s protocol. PCR reactions were performed with pathogen-specific primers using Maxime PCR PreMix kit (iNtRON, Korea). The specific primers (given in 5’ to 3’ direction) for each of LACV, RVFV, and BUNV are given in Supplementary Table 1 Each of viruses (LACV, RVFV, and BUNV) positive controls were used by the Bioneer, Corporation, Korea (AccuGeneBlock synthetically service).

The PCR profile was 95oC for 5 min; 38 cycles of 95oC for 20 s, 56oC for 30 s, 72oC for 40 s; and final extension at 72oC for 10 min. Of the total 586 samples, none were found to be positive with LACV, RVFV, and BUNV. Also, no positive samples were detected according to seasons of the year (Table 1).

RT-PCR screening results according to the age and month
  No. of positive   No. of positive (positive rate %)
Age * (positive rate %) Month
  LACV RVFV BUNV   LACV RVFV BUNV
Gilt (n=69) 0 0 0 January (n=42) 0 0 0
Sow (n=106) 0 0 0 February(n=43) 0 0 0
Suckling (n=96) 0 0 0 March (n=40) 0 0 0
Weaned (n=90) 0 0 0 April (n=40) 0 0 0
Grower (n=105) 0 0 0 May (n=64) 0 0 0
Finisher (n=120) 0 0 0 June (n=72) 0 0 0
        July (n=79) 0 0 0
        August (n=69) 0 0 0
September (n=49) 0 0 0
October (n=51) 0 0 0
November (n=37) 0 0 0
Grand total 0 0 0 Grand total 0 0 0
(n=586) (n=586)

Samples were sorted into six groups: female (gilt and sow), suckling (<30 days), weaned (30-60 days), grower (60-90 days); and finisher (≥90 days)

In conclusion, this preliminary survey found no evidence for the presence of LACV, RVFV, and BUNV in pigs, in Korea. In the next phase, attempts will be done for serological survey against the above mentioned viruses. In addition, because LACV, RVFV, and BUNV are arthropod-borne viruses, it is important to examine mosquitoes for the presence of the viruses.

 Acknowledgments

This study was supported by a grant (#PJ009015) from BioGreen 21Program, Republic of Korea.

 Author Disclosure Statement

No competing financial interests exist.

Supplementary data: Sequences of specific primers used in this study
Virus Primer Targetgene Sequence (5’-3’) Size (bp)
La crosse virus LACV-F S GGCATTCACAGAGTCAAGCA 361bp
LACV-R TTTTTGCTGTCC CCTACCAC
Rift valley fever virus RVFV-F S ACAAGCCCAAAAGCTTTCAA 444bp
RVFV-R GAAAGAAGGCAAGGCAACG
Bunyamwera virus BUNV-F M CGATCACAGACTGGAAAGCA 527bp
BUNV-R ACTCCTGTTGTACGCCCATC
Locations of investigated swine farms for LACV, RVFV, and BUNV. Lambert A J Blair C D D'Anton M Ewing W Harborth M Seiferth R Xiang J Lanciotti R S La Crosse virus in Aedes albopictus mosquitoes 2010 Emerging Infectious Diseases 16 856 858 Texas, USA Kim K H Yi J Kim G Choi S J Jun K I Kim N H Choe P G Kim N J Lee J K Oh M D Severe fever with thrombocytopenia syndrome, South Korea 2013 Emerging Infectious Diseases 19 1892 1894 Pachler K Růžek D Nowotny N Molecular characterization of the African orthobunyavirus Ilesha virus 2013 Infection, Genetics and Evolution 20 124 130 Coetzer J The pathology of Rift Valley fever. II. Lesions occurring in field cases in adult cattle, calves and aborted foetuses 1982 The Onderstepoort Journal of Veterinary Research 49 11 Cha G Jeong Y Lee E Kang B Lee E Choi E Kim H Han M Park C Detection of new flavivirus from Ades mosquito in South Korea,2011 2012 International Journal of Infectious Diseases 16 249