<?xml version="1.0" encoding="utf8"?>
 <!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.0 20120330//EN" "http://jats.nlm.nih.gov/publishing/1.0/JATS-journalpublishing1.dtd"> <article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.0" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">JCGB</journal-id>
      <journal-title-group>
        <journal-title>Journal of Cancer Genetics And Biomarkers</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2572-3030</issn>
      <publisher>
        <publisher-name>Open Access Pub</publisher-name>
        <publisher-loc>United States</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="publisher-id">JCGB-22-4121</article-id>
      <article-id pub-id-type="doi">10.14302/issn.2572-3030.jcgb-22-4121</article-id>
      <article-categories>
        <subj-group>
          <subject>research-article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Targeting Mutational Landscape of TP53 in patients diagnosed with Oral Cancer living in Senegal</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>SARR</surname>
            <given-names>Pierre Diaga</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842271108">1</xref>
          
          <xref ref-type="aff" rid="idm1842273636">2</xref>
          <xref ref-type="corresp" rid="cor1">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>TOURE</surname>
            <given-names>Silly</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842286964">3</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>EL</surname>
            <given-names>FAHIME Elmostafa</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842015716">4</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>DIOP</surname>
            <given-names>Jean Pascal Demba</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842271108">1</xref>
          <xref ref-type="aff" rid="idm1842273636">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>BA</surname>
            <given-names>Seydi Abdoul</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842271108">1</xref>
          <xref ref-type="aff" rid="idm1842273636">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>DIA</surname>
            <given-names>Yacouba</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842271108">1</xref>
          <xref ref-type="aff" rid="idm1842273636">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>MBENGUE</surname>
            <given-names>Babacar</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842015860">5</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>SYLLA-NIANG</surname>
            <given-names>Maguette</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842015860">5</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>DIEYE</surname>
            <given-names>Alioune</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842015860">5</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>NDIAYE-DIALLO</surname>
            <given-names>Rokhaya</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842271108">1</xref>
          <xref ref-type="aff" rid="idm1842273636">2</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1842271108">
        <label>1</label>
        <addr-line>Laboratory of Clinical Cytology, Cytogenetics and Reproduction Biology, Aristide Le Dantec Hospital, Dakar-Senegal</addr-line>
      </aff>
      <aff id="idm1842273636">
        <label>2</label>
        <addr-line>Division of Human Genetics, Faculty of Medicine, Pharmacy and Odonto-Stomatology, Cheikh Anta Diop University, Dakar-Senegal</addr-line>
      </aff>
      <aff id="idm1842286964">
        <label>3</label>
        <addr-line>Department of Stomatology and Maxillofacial Surgery, Aristide Le Dantec Hospital, Dakar-Senegal</addr-line>
      </aff>
      <aff id="idm1842015716">
        <label>4</label>
        <addr-line>Functional Genomic Platform, National Center for Scientific and Technical Research, Rabat-Morocco</addr-line>
      </aff>
      <aff id="idm1842015860">
        <label>5</label>
        <addr-line>Immunology Unit, Faculty of Medicine, Pharmacy and Odonto-Stomatology, Cheikh Anta Diop University, Senegal.</addr-line>
      </aff>
      <contrib-group>
        <contrib contrib-type="editor">
          <name>
            <surname>Qingwen</surname>
            <given-names>Xu</given-names>
          </name>
          <xref ref-type="aff" rid="idm1842017732">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1842017732">
        <label>1</label>
        <addr-line>United States.</addr-line>
      </aff>
      <author-notes>
        <corresp id="cor1">Correspondence: Pierre Diaga Sarr, Division of Human Genetics, Faculty of Medicine, Pharmacy and Odonto-Stomatology, Cheikh Anta Diop University, Dakar, Senegal; Email: <email>lordpeter.mcsarr@gmail.com</email>.</corresp>
        <fn fn-type="conflict" id="idm1850957124">
          <p>The authors have declared that no competing interests exist.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub" iso-8601-date="2022-03-11">
        <day>11</day>
        <month>03</month>
        <year>2022</year>
      </pub-date>
      <volume>1</volume>
      <issue>4</issue>
      <fpage>22</fpage>
      <lpage>32</lpage>
      <history>
        <date date-type="received">
          <day>03</day>
          <month>03</month>
          <year>2022</year>
        </date>
        <date date-type="accepted">
          <day>09</day>
          <month>03</month>
          <year>2022</year>
        </date>
        <date date-type="online">
          <day>11</day>
          <month>03</month>
          <year>2022</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© </copyright-statement>
        <copyright-year>2022</copyright-year>
        <copyright-holder>SARR Pierre Diaga, et al.</copyright-holder>
        <license xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="http://openaccesspub.org/jcgb/article/1787">This article is available from http://openaccesspub.org/jcgb/article/1787</self-uri>
      <abstract>
        <sec id="idm1841991348">
          <title>Introduction</title>
          <p>Genomic mutations in <italic>TP53</italic> gene in                association with etiological risk factors have been associated with oral carcinogenesis. Herein, we screened for genomic variants of <italic>TP53 </italic>predisposing to oral cancers in Senegalese patients.</p>
        </sec>
        <sec id="idm1841989188">
          <title>Methodology</title>
          <p>88 patients with confirmed diagnostic were recruited after informed consent. Blood samples were collected from each patient to perform DNA extraction, PCR amplification of all coding exons of <italic>TP53 </italic>followed by Sanger Sequencing of PCR products. Nucleotide sequences were analysed with Genalys software. 94 blood donors with no cancer diagnosis were also recruited as controls for association study between the most common variants identified in            patients and predisposition to oral cancers.</p>
        </sec>
        <sec id="idm1841989980">
          <title>Results</title>
          <p>Sequence analysis showed that 52.27% of patients carry at least one mutation in <italic>TP53</italic>. Eleven genomic variants were identified, 7 variants already reported in databases and 4 new variants. The most recurrent variants in this study already reported as cancer-related variants were Pro72Arg (rs1042522; Arginine frequency estimated at 31.26%) and a 16 bp insertion in intron 3 (rs59758982; allelic frequency estimated at 26.25%). Haplotype analysis between these variants showed a strong linkage disequilibrium (D’ = 0.999,            r<sup>2</sup> = 0.153 and p-value &lt; 0.05). However, association study did not find any significant association with susceptibility to oral cancer (p-value &gt; 0.05).</p>
        </sec>
        <sec id="idm1841988108">
          <title>Conclusion</title>
          <p>Our study highlighted that despite the absence of association between the two most common cancer-related variants in Senegalese patients diagnosed with oral               cancer, their strong LD suggested that they could be      transmitted together in a common haplotype which may be implicated in oral carcinogenesis.</p>
        </sec>
      </abstract>
      <kwd-group>
        <kwd>TP53 gene</kwd>
        <kwd>Genomic variant</kwd>
        <kwd>Senegal</kwd>
        <kwd>Oral cancers</kwd>
        <kwd>susceptibility</kwd>
        <kwd/>
      </kwd-group>
      <counts>
        <fig-count count="1"/>
        <table-count count="6"/>
        <page-count count="11"/>
      </counts>
    </article-meta>
  </front>
  <body>
    <sec id="idm1841987460" sec-type="intro">
      <title>Introduction</title>
      <p>With an estimated incidence of nearly 300.000 new cases per year and a mortality rate around 50%, oral cancers are major challenge in oncology and represent the sixth leading cancer worldwide, according to  GLOBOCAN report 2018 <xref ref-type="bibr" rid="ridm1842314268">1</xref>.</p>
      <p>The main risk factors are exposure to genotoxic agents such as tobacco, alcohol and betel nut                         chewing <xref ref-type="bibr" rid="ridm1842380796">2</xref><xref ref-type="bibr" rid="ridm1842394116">3</xref><xref ref-type="bibr" rid="ridm1842385836">4</xref>.These agents induced genetic alteration in genes controlling the cell cycle such as <italic>TP53</italic><xref ref-type="bibr" rid="ridm1842169076">5</xref><xref ref-type="bibr" rid="ridm1842166772">6</xref><xref ref-type="bibr" rid="ridm1842155572">7</xref>. Also, poor oral hygiene, bad set of teeth, inadequate diet and poor nutrition, or immunosuppression, may increase oral cancer risk by promoting chronic infections of the oral mucosa with high risk Human Papilloma Virus (HPV), by inducing loss of function of <italic>TP53</italic> encoded protein <xref ref-type="bibr" rid="ridm1842152260">8</xref><xref ref-type="bibr" rid="ridm1842157804">9</xref><xref ref-type="bibr" rid="ridm1842141108">10</xref>.</p>
      <p>Mutations of <italic>TP53</italic> gene have been reported as the main driver event of carcinogenesis <xref ref-type="bibr" rid="ridm1842146652">11</xref>. Missense                  variants have been reported in the coding region of the DNA Binding Domain of p53 protein which specifically binds to the promoters of targeted genes.</p>
      <p>Eight hotspot amino-acid substitutions in the DNA Binding Domain of p53, characterizing almost 27% of              mutant proteins, were identified in human cancers while they are not directly cancer associated (Arg175His, Gly245Ser, Arg248Gln, Arg248Trp, Arg249Ser, Arg273His, Arg273Ser, and Arg282Trp) <xref ref-type="bibr" rid="ridm1842130540">12</xref>. In mice model, the               introduction of the Arg172His mutation corresponding to human Arg175His, has been associated with the functional inactivation of p63 and p73 proteins <xref ref-type="bibr" rid="ridm1842127156">13</xref><xref ref-type="bibr" rid="ridm1842130540">12</xref>.</p>
      <p>Other variants are located in a 1kb region                  spanning intron 3 to intron 4 containing the 6 cancer-related variants reported in IARC <italic>TP53 </italic>database <xref ref-type="bibr" rid="ridm1842123628">14</xref>: a 16 bp insertion in intron 3 (NG_017013.2:g.16185_16200Ins, rs59758982), two variants located in exon 4 coding for the Proline-rich domain of p53 (Pro47Ser : NG_017013.2:g.16321C&gt;T, rs1800371) and Pro72Arg : NG_017013.2:g.16397C&gt;G, (rs1042522)), and 2 variants located in intron 4 (NG_017013.2:g.17032T&gt;C (rs1794287) and NG_017013.2:g.17198G&gt;A (rs35850753) (<xref ref-type="fig" rid="idm1850598316">Figure 1</xref>).</p>
      <fig id="idm1850598316">
        <label>Figure 1.</label>
        <caption>
          <title> Cancer-related variants of TP53 encompassing exons 4</title>
        </caption>
        <graphic xlink:href="images/image1.jpg" mime-subtype="jpg"/>
      </fig>
      <p>Effect predictions of these cancer related variants in Varsome database have shown benign effect (rs1800371, rs78378222 and rs35850753) or uncertain significance (rs59758982, rs1042522 and rs1794287), although functional/association studies are in favour of cancer predisposition (<xref ref-type="table" rid="idm1850582596">Table 1</xref>).</p>
      <table-wrap id="idm1850582596">
        <label>Table 1.</label>
        <caption>
          <title> VarSome effect predictions and functional study findings on cancer-related variants reported in IARC TP53 database</title>
        </caption>
        <table rules="all" frame="box">
          <tbody>
            <tr>
              <td>Genetic variations</td>
              <td>Location</td>
              <td>rs number</td>
              <td>Effect Prediction</td>
              <td>Functional/Association study findings</td>
            </tr>
            <tr>
              <td>NG_017013.2:g.16185_16200Ins</td>
              <td>Intron 3</td>
              <td>rs59758982</td>
              <td>VUS</td>
              <td>Association with increased risk of colorectal cancer and reduced level of <italic>TP53</italic> mRNA in lymphoblastoïd cell-lines [<ext-link xlink:href="file:///C:\Users\user\Downloads\4121_%5bPierre%20Diaga%20SARR%5d%20Manuscript.docx" ext-link-type="uri">15</ext-link>]</td>
            </tr>
            <tr>
              <td>NG_017013.2:g.16321C&gt;T(p.Pro47Ser)</td>
              <td>Exon 4</td>
              <td>rs1800371</td>
              <td>Benign</td>
              <td>Association with breast cancer risk [<ext-link xlink:href="file:///C:\Users\user\Downloads\4121_%5bPierre%20Diaga%20SARR%5d%20Manuscript.docx" ext-link-type="uri">17</ext-link>]</td>
            </tr>
            <tr>
              <td>NG_017013.2:g.16397C&gt;G(p.Pro72Arg)</td>
              <td>Exon 4</td>
              <td>rs1042522</td>
              <td>VUS</td>
              <td>Association with altered electrophoretic mobility and, a conformational and functional modifications of the p53mutant protein [<ext-link xlink:href="file:///C:\Users\user\Downloads\4121_%5bPierre%20Diaga%20SARR%5d%20Manuscript.docx" ext-link-type="uri">18</ext-link>]</td>
            </tr>
            <tr>
              <td>NG_017013.2:g.17032T&gt;C</td>
              <td>intron 4</td>
              <td>rs1794287</td>
              <td>VUS</td>
              <td>Affect the activity of <italic>TP53</italic> internal promoter [<ext-link xlink:href="file:///C:\Users\user\Downloads\4121_%5bPierre%20Diaga%20SARR%5d%20Manuscript.docx" ext-link-type="uri">20</ext-link>]</td>
            </tr>
            <tr>
              <td>NG_017013.2:g.17198G&gt;A</td>
              <td>intron 4</td>
              <td>rs35850753</td>
              <td>Benign</td>
              <td>Association with neuroblastoma [<ext-link xlink:href="file:///C:\Users\user\Downloads\4121_%5bPierre%20Diaga%20SARR%5d%20Manuscript.docx" ext-link-type="uri">21</ext-link>]</td>
            </tr>
            <tr>
              <td>NG_017013.2:g.24117A&gt;C</td>
              <td>3’ UTR</td>
              <td>rs78378222</td>
              <td>Benign</td>
              <td>Association with neuroblastoma [<ext-link xlink:href="file:///C:\Users\user\Downloads\4121_%5bPierre%20Diaga%20SARR%5d%20Manuscript.docx" ext-link-type="uri">21</ext-link>]</td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn id="idm1841969252">
            <label/>
            <p>UTR: Untranslated region   </p>
          </fn>
          <fn id="idm1841968820">
            <label/>
            <p>VUS: Variant of Uncertain Significance </p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <p>The 16 bp insertion in intron 3 (rs59758982) has been associated with increased risk of colorectal cancer in a case-control study and correlated with a reduced level of <italic>TP53</italic> mRNA in lymphoblastoid cell-lines <xref ref-type="bibr" rid="ridm1842136228">15</xref>. The Pro47Ser variant (rs1800371) has been reported in               populations of African ancestry (allelic frequency                     estimated at 2-4% in Africa and 1.2% in                                 African-Americans) <xref ref-type="bibr" rid="ridm1842131692">16</xref> and have been associated with increased risk of breast cancer among pre-menopausal women <xref ref-type="bibr" rid="ridm1842101884">17</xref>. The Pro72Arg (rs1042522) is a                                non-conserved amino acid with reported altered                       electrophoretic mobility, conformation and function of themutant protein <xref ref-type="bibr" rid="ridm1842097348">18</xref>. This variant shows significant ethnic bias with Arginine allelic frequencies estimated at ~72% for Europeans compared to ~38% for African and                    African-Americans and ~51% for Asian populations (gnomAD database: https://gnomad.broadinstitute.org/variant/17-7579472-G-C?dataset=gnomad_r2_1). In a  previous study, we showed in an ethnicity-stratified          meta-analysis that this variant is associated with oral              cancers risk in Asian population (OR = 1.31; CI<sub>95% </sub>=1.09 - 1.58; p=0.004) whereas any significant association was observed in Africans and Caucasians <xref ref-type="bibr" rid="ridm1842091300">19</xref>.</p>
      <p>Two other cancer-related variants (rs1794287) and (rs35850753) are located in intron 4 and were shown to affect the activity of <italic>TP53 </italic>intron 4 internal promoter by changing its affinity with several transcription factors <xref ref-type="bibr" rid="ridm1842106564">20</xref>. The last variant (rs78378222) maps to the                        polyadenylation signal located in 3´ UTR of <italic>TP53</italic>. This  variant is in linkage disequilibrium with rs35850753 in intron 4 and both have been associated with n                          euroblastoma (rs35850753: OR = 2.7, CI<sub>95%</sub> = (2.0 - 3.6); rs78378222: OR = 2.3, CI<sub>95%</sub> = (1.8 - 2.9) <xref ref-type="bibr" rid="ridm1842080172">21</xref>.</p>
      <p>In Sub-Saharan Africa, very few studies have                   investigated genetic variability of <italic>TP53</italic> and its association with cancer risk. Here we screened for <italic>TP53 </italic>genomic            variants predisposing to oral cancers in patients living in Senegal.</p>
    </sec>
    <sec id="idm1841966444">
      <title>Population and Methods </title>
      <p>The study was carried out from January 2018 to September 2021 through a collaboration between the  Department of Stomatology and Maxillofacial Surgery of Aristide Le Dantec Hospital in Dakar for patients                 recruitment, the Senegalese National Blood Transfusion Center for the recruitment of healthy blood donor                controls, the department of Human Genetics of the Faculty of Medicine, Pharmacy and Odontology of Cheikh Anta Diop University Dakar for DNA extraction and PCR                  amplification, and the Functional Genomics Platform of the National Center for Scientific and Technical Research (CNRST) of Rabat (Morocco) for Sanger sequencing of PCR products. The research protocol was approved by the             Ethics Committee of Cheikh Anta Diop University under reference 0320/2018/CER/UCAD.</p>
      <sec id="idm1841968172">
        <title>Study Population</title>
        <p>Patients with confirmed diagnosis of oral cancer undergoing treatment at the Department of Stomatology and Maxillofacial Surgery of Aristide Le Dantec Hospital were recruited after informed consent. A questionnaire was filled out by each patient providing information about age, gender, ethnicity, alcohol and tobacco status, tumor location and histology, and disease stage.</p>
        <p>94 healthy blood donors without cancer were also recruited as controls. For each individual a blood sample was collected for DNA extraction. </p>
      </sec>
      <sec id="idm1841967596">
        <title>DNA Isolation, PCR Amplification of TP53 Coding Exons</title>
        <p>DNA was isolated from blood samples using  Quick-DNA™ MiniPrep (Zymo Research) following                           manufacturer’s protocol. DNA extract were quantified with a spectrophotometer (SimpliNano™, Biochrom). PCR amplifications of the 10 coding exons (exons 2 to 11) of <italic>TP53</italic> gene were processed with seven primer sets at               specific annealing temperatures (<xref ref-type="table" rid="idm1850513164">Table 2</xref>). PCR conditions were as follow: initial denaturation at 95°C for 10 min; 40 cycles of denaturation at 94°C for 30s, primer annealing for 30s, and extension at 72°C for 30s. A final extension step followed at 72°C for 10 min. PCR products were             visualized by electrophoresis in a 1.5% agarose gel.</p>
        <table-wrap id="idm1850513164">
          <label>Table 2.</label>
          <caption>
            <title> Primer sets and annealing temperature of TP53 coding exons</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>Fragments; 
length in pb</td>
                <td>Sequence of Primer sets</td>
                <td>
                  <bold>Annealing temperature</bold>
                </td>
              </tr>
              <tr>
                <td>Exon 2</td>
                <td>E2F : CAGCCATTCTTTTCCTGCTC</td>
                <td>62<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>355</td>
                <td>E2R : TCCCACAGGTCTCTGCTAGG</td>
                <td/>
              </tr>
              <tr>
                <td>Exons 3 &amp; 4</td>
                <td>E3F : CCCCCTCTGAGTCAGGAAACA</td>
                <td>55<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>765</td>
                <td>E4R : ACAGGAGTCAGAGATCACACA</td>
                <td/>
              </tr>
              <tr>
                <td>Exons 5 &amp; 6</td>
                <td>E5F : TGAGGTGTAGACGCCAACTCT</td>
                <td>55<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>668</td>
                <td>E6R : GGGAGGTCAAATAAGCAGCA</td>
                <td/>
              </tr>
              <tr>
                <td>Exon 7</td>
                <td>E7F : CTTGCCACAGGTCTCCCCAA</td>
                <td>60<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>237</td>
                <td>E7R : AGGGGTCAGCGGCAAGCAGA</td>
                <td/>
              </tr>
              <tr>
                <td>Exons 8 &amp; 9</td>
                <td>E8F : TTGGGAGTAGATGGAGCCTG</td>
                <td>60<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>473</td>
                <td>E9R : AAACAGTCAAGAAGAAAACGGC</td>
                <td/>
              </tr>
              <tr>
                <td>Exon 10</td>
                <td>E10F : GCTGTATAGGTACTTGAAG</td>
                <td>55<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>343</td>
                <td>E10R : GCTTTCCAACCTAGGAAGGCAG</td>
                <td/>
              </tr>
              <tr>
                <td>Exon 11</td>
                <td>E11F : GATTTGAATTCCCGTTGTCC</td>
                <td>55<sup>0</sup>C</td>
              </tr>
              <tr>
                <td>324</td>
                <td>E11R : CAAGGGTTCAAAGACCCAAA</td>
                <td/>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>The 16 bp insertion in intron 3 was genotyped in control population by PCR amplification using forward (TGCTCTTGTCTTTCAGACTTCCT) and reverse primer (GAGCAGTCAGAGGACCAGGTC) at 62°C annealing temperature during 30s. PCR products were visualized in a 3% agarose gel after electrophoresis at 100 volts for an hour. Two fragments were observed (114bp for the insertion allele and 130bp for the wild type allele).</p>
        <p>The Pro72Arg variant (c.215C&gt;G) was genotyped in controls by PCR-RFLP as previously reported <xref ref-type="bibr" rid="ridm1842078444">22</xref>.</p>
      </sec>
      <sec id="idm1841907740">
        <title>Sanger Sequencing of PCR Products and Sequence Analysis</title>
        <p>PCR products were cleaned with PureLink™ Quick Gel Purification kit (Invitrogen) according to                          manufacturer’s protocol. Cleaned PCR products were            sequenced with BigDye™ Terminator kit (Applied                    Biosystems)  and loaded on a SeqStudio™ Genetic                    Analyzer System 4 capillary (Applied Biosystems).</p>
        <p>Sequences analysis were performed with Genalys Software (version 3.3.42a) and mapped to the reference sequence of <italic>TP53 </italic>gene (NG_017013.2) for variants          detection. Clinical significance of identified variants was checked on ClinVar, dbSNP, VarSome and gnomAD                  databases. For newly identified variants, we predicted their biological effects with SIFT and PolyPhen2 tools.</p>
      </sec>
      <sec id="idm1841904428">
        <title>Statistical Analysis</title>
        <p>Linkage Desequilibrium (LD) was tested with Haploview Software (version 4.1). The association                between the most common variants and predisposition to oral cancers was checked in a case/control study.                    Association parameters (odds ratio (OR), 95% confidence interval (CI<sub>95%)</sub> and p-value) were estimated through an online dedicated website <xref ref-type="bibr" rid="ridm1842073332">23</xref>.</p>
      </sec>
    </sec>
    <sec id="idm1841905508" sec-type="results">
      <title>Results </title>
      <sec id="idm1841905220">
        <title>Characteristics of Study Population</title>
        <p>The study population included 88 patients                 diagnosed with oral cancers. Mean age at diagnosis was 51.90 ±17.98 years with ages ranging from 18 to 85 years. Sex ratio was in favor of females (0.76) and most of our patients (73%) had a negative alcohol-tobacco status.    Tumor histology showed that 90.9% were squamous cell carcinoma. Tumors were preferentially located in the tongue (22.7%), followed by gum (20.5%), cheek mucosa (19.3%), facial massif (8%), lips (6.8%), oral floor (3.4%), palate (2.3%), mandible (2.3%) and maxillary (1.1%) (<xref ref-type="table" rid="idm1850455916">Table 3</xref>).</p>
        <table-wrap id="idm1850455916">
          <label>Table 3.</label>
          <caption>
            <title> Characteristics of recruited patients </title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <th>
                  <bold>Characteristics                                              </bold>
                </th>
                <td>
                  <bold>Parameters</bold>
                </td>
                <td>
                  <bold>Values</bold>
                </td>
              </tr>
              <tr>
                <td>
                  <bold>Age</bold>
                </td>
                <td>Mean age ± standard deviation</td>
                <td>51.90 ± 17.98</td>
              </tr>
              <tr>
                <td/>
                <td>Median age <sup>extreme values</sup></td>
                <td>55 (18 – 85)</td>
              </tr>
              <tr>
                <td colspan="2">
                  <bold>Sex-ratio</bold>
                </td>
                <td>0.76 (38/50)</td>
              </tr>
              <tr>
                <td>
                  <bold>Smoking and alcohol status</bold>
                </td>
                <td>-</td>
                <td>73 %</td>
              </tr>
              <tr>
                <td/>
                <td>+</td>
                <td>5.5 %</td>
              </tr>
              <tr>
                <td/>
                <td>Not specified</td>
                <td>21.5 %</td>
              </tr>
              <tr>
                <td>
                  <bold>Tumor</bold>
                  <bold> location</bold>
                </td>
                <td>Tongue</td>
                <td>22.7 %</td>
              </tr>
              <tr>
                <td/>
                <td>Gum</td>
                <td>20.5 %</td>
              </tr>
              <tr>
                <td/>
                <td>Cheek mucosa</td>
                <td>19.3 %</td>
              </tr>
              <tr>
                <td/>
                <td>Facial massif</td>
                <td>8 %</td>
              </tr>
              <tr>
                <td/>
                <td>Lips</td>
                <td>6.8 %</td>
              </tr>
              <tr>
                <td/>
                <td>Oral floor</td>
                <td>3.4 %</td>
              </tr>
              <tr>
                <td/>
                <td>Palate</td>
                <td>2.3 %</td>
              </tr>
              <tr>
                <td/>
                <td>Mandible</td>
                <td>2.3 %</td>
              </tr>
              <tr>
                <td/>
                <td>Maxillary</td>
                <td>1.1 %</td>
              </tr>
              <tr>
                <td/>
                <td>Multiple locations</td>
                <td>11.3 %</td>
              </tr>
              <tr>
                <td/>
                <td>Not specified</td>
                <td>2.3 %</td>
              </tr>
              <tr>
                <td>
                  <bold>Tumor</bold>
                  <bold> histology</bold>
                </td>
                <td>Squamous cell carcinoma</td>
                <td>90.9 %</td>
              </tr>
              <tr>
                <td/>
                <td>Adenocarcinoma</td>
                <td>1.1 %</td>
              </tr>
              <tr>
                <td/>
                <td>Burkitt lymphoma</td>
                <td>1.1 %</td>
              </tr>
              <tr>
                <td/>
                <td>Not specified</td>
                <td>6.9 %</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="idm1841889820">
        <title>TP53 Mutation Screening </title>
        <p>The proportion of patients carrying at least one mutation in <italic>TP53</italic> was 52.27%. Sequence analysis                 identified 11 genomic variations, 10 Single Nucleotide Variant (SNV) and one Copy Number Variation (CNV)             located in intron 3. Among identified variants, seven have been reported in Clinvar, dbSNP or gnomAD databases:  c.63C&gt;T (p.Asp=, rs1800369); c.215C&gt;G (p.Pro72Arg, rs1042522); c.692C&gt;T (p.Thr231Ile, rs1555525564); c.745A&gt;T (p.Arg249Trp, rs587782082); c.773A&gt;T (p.Glu258Asp, rs2073239956); c.776A&gt;T (p.Asp259Val, rs745425759) and the CNV (GGGCTGGGGACCTGGA, NG_017013.2:g.16185_16200Ins, rs59758982).</p>
        <p>We have identified four new variants not yet             reported in variant databases: c.62A&gt;C (p.Asp21Ala); c.64C&gt;G (p.Leu22Val); c.268T&gt;A (p.Ser90Thr) and c.773A&gt;T (p.Glu258Val). Each of them was detected in one patient in the study population. Effect prediction with SIFT and PolyPhen highlighted possibly damaging effect (c.62A&gt;C (p.Asp21Ala); c.773A&gt;T (p.Glu258Val)) and benign effect (c.64C&gt;G (p.Leu22Val); c.268T&gt;A (p.Ser90Thr) (<xref ref-type="table" rid="idm1850354620">Table 4</xref>).</p>
        <table-wrap id="idm1850354620">
          <label>Table 4.</label>
          <caption>
            <title> TP53 mutations identified in patients with oral cancer and their clinical significance</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>
                  <bold>c(g)DNA description</bold>
                </td>
                <td>
                  <bold>rs</bold>
                  <bold>                number</bold>
                </td>
                <td><bold>Genomic location  </bold>(GRCh38)</td>
                <td>
                  <bold>Exon/Intron</bold>
                  <bold>location</bold>
                </td>
                <td>
                  <bold>Protein </bold>
                  <bold>effect</bold>
                </td>
                <td>
                  <bold>Variant Clinical significance (</bold>
                  <bold>ClinVar</bold>
                  <bold>, </bold>
                  <bold>dbSNP</bold>
                  <bold> &amp; </bold>
                  <bold>gnomAD</bold>
                  <bold>) vs. Effect                Prediction (SIFT &amp;                </bold>
                  <bold>PolyPhen</bold>
                  <bold>)</bold>
                </td>
                <td>
                  <bold>Alternative allele              frequency</bold>
                </td>
              </tr>
              <tr>
                <td>
                  <bold>c.62A&gt;C</bold>
                </td>
                <td>
                  <bold>---</bold>
                </td>
                <td>
                  <bold>17:7676533</bold>
                </td>
                <td>
                  <bold>Exon 2</bold>
                </td>
                <td>
                  <bold>p.Asp</bold>
                  <bold>21Ala</bold>
                </td>
                <td>
                  <bold>Possibly damaging (</bold>
                  <bold>PolyPhen</bold>
                  <bold>)</bold>
                </td>
                <td>
                  <bold>0.57 % (01/88)</bold>
                </td>
              </tr>
              <tr>
                <td>c.63C&gt;T</td>
                <td>rs1800369</td>
                <td>17:7676532</td>
                <td>Exon 2</td>
                <td>p.Asp21=</td>
                <td>Conflicting interpretations of pathogenicity (ClinVar &amp; dbSNP)</td>
                <td>0.57 % (01/88)</td>
              </tr>
              <tr>
                <td>
                  <bold>c.64C&gt;G</bold>
                </td>
                <td>
                  <bold>---</bold>
                </td>
                <td>
                  <bold>17:7676531</bold>
                </td>
                <td>
                  <bold>Exon 2</bold>
                </td>
                <td>
                  <bold>p.Leu</bold>
                  <bold>22Val</bold>
                </td>
                <td>
                  <bold>Benign (</bold>
                  <bold>PolyPhen</bold>
                  <bold>)</bold>
                </td>
                <td>
                  <bold>0.57 % (01/88)</bold>
                </td>
              </tr>
              <tr>
                <td>g.16185_16200Ins</td>
                <td>rs59758982</td>
                <td>17:7676351_7676366Ins</td>
                <td>Intron 3</td>
                <td>---</td>
                <td>Benign ; Likely-benign ; Hereditary cancer-predisposing syndrome (ClinVar &amp; dbSNP)</td>
                <td>26.25 % (18/40)</td>
              </tr>
              <tr>
                <td>c.215C&gt;G</td>
                <td>rs1042522</td>
                <td>17:7676154</td>
                <td>Exon 4</td>
                <td>p.Pro72Arg</td>
                <td>Uncertain clinical significance ; pathogenic (ClinVar &amp; dbSNP) ;            Tolerated (SIFT) ; Benign (PolyPhen)</td>
                <td>31.26 % (23/48)</td>
              </tr>
              <tr>
                <td>
                  <bold>c.268T&gt;A</bold>
                </td>
                <td>
                  <bold>---</bold>
                </td>
                <td>
                  <bold>17:7676101</bold>
                </td>
                <td>
                  <bold>Exon 4</bold>
                </td>
                <td>
                  <bold>p.Ser</bold>
                  <bold>90Thr</bold>
                </td>
                <td>
                  <bold>Benign (</bold>
                  <bold>PolyPhen</bold>
                  <bold>)</bold>
                </td>
                <td>
                  <bold>1.02 % (01/49)</bold>
                </td>
              </tr>
              <tr>
                <td>c.692C&gt;T</td>
                <td>rs1555525564</td>
                <td>17:7674271</td>
                <td>Exon 7</td>
                <td>p.Thr231Ile</td>
                <td>Uncertain clinical significance (ClinVar &amp; dbSNP) ; Deleterious (SIFT) ;               Probably damaging (PolyPhen)</td>
                <td>0.98 % (01/51)</td>
              </tr>
              <tr>
                <td>c.745A&gt;T</td>
                <td>rs587782082</td>
                <td>17:7674218</td>
                <td>Exon 7</td>
                <td>p.Arg249Trp</td>
                <td>Uncertain clinical significance ; likely pathogenic ; Deleterious (SIFT) ;            Possibly damaging (PolyPhen)</td>
                <td>2.94 % (03/51)</td>
              </tr>
              <tr>
                <td>
                  <bold>c.773A&gt;T</bold>
                </td>
                <td>
                  <bold>---</bold>
                </td>
                <td>
                  <bold>17:7674190</bold>
                </td>
                <td>
                  <bold>Exon 7</bold>
                </td>
                <td>
                  <bold>p.Glu</bold>
                  <bold>258Val</bold>
                </td>
                <td>
                  <bold>Probably damaging (</bold>
                  <bold>PolyPhen</bold>
                  <bold>)</bold>
                </td>
                <td>
                  <bold>0.98 % (01/51)</bold>
                </td>
              </tr>
              <tr>
                <td>c.773A&gt;T</td>
                <td>rs2073239956</td>
                <td>17:7674189</td>
                <td>Exon 7</td>
                <td>p.Glu258Asp</td>
                <td>Clinical significance not reported in Clinvar &amp; dbSNP ;                                               Probably damaging (PolyPhen)</td>
                <td>1.96 % (02/51)</td>
              </tr>
              <tr>
                <td>c.776A&gt;T</td>
                <td>rs745425759</td>
                <td>17:7674187</td>
                <td>Exon 7</td>
                <td>p.Asp259Val</td>
                <td>Uncertain significance (ClinVar &amp; dbSNP) ;               Deleterious (SIFT) ;    Possibly damaging (PolyPhen)</td>
                <td>0.98 % (01/51)</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>The most recurrent variants were two                            cancer-related variants reported in IARC <italic>TP53 </italic>database: p.Pro72Arg (rs1042522; Arginine allelic frequency                 estimated at 31.26%) and the CNV located in intron 3 (rs59758982; alternative allelic frequency estimated at 26.25%). Since these variants are located closely in the genomic region spanning intron 3 to exon 4, we then             tested for linkage desequilibrium (LD) and found a strong LD (<xref ref-type="table" rid="idm1850238892">Table 5</xref>).</p>
        <table-wrap id="idm1850238892">
          <label>Table 5.</label>
          <caption>
            <title> Linkage desequilibrium calculation between the two most frequent variants</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <th>
                  <bold>Markers</bold>
                </th>
                <td>
                  <bold>D</bold>
                </td>
                <td>
                  <bold>D’</bold>
                </td>
                <td>
                  <bold>r</bold>
                  <sup>2</sup>
                </td>
                <td>
                  <bold>p-value</bold>
                </td>
              </tr>
              <tr>
                <td>
                  <bold>rs59758982 vs. rs1042522</bold>
                </td>
                <td>-0.079</td>
                <td>0.999</td>
                <td>0.153</td>
                <td>0.000551698</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>Case/controls association study between the two most frequent variants and oral cancer predisposition did not raise any significant association in the study                     population (<xref ref-type="table" rid="idm1850224420">Table 6</xref>).</p>
        <table-wrap id="idm1850224420">
          <label>Table 6.</label>
          <caption>
            <title> Case/control association study of rs59758982 and rs1042522 with predisposition to oral cancer</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <th>
                  <bold>Variants</bold>
                </th>
                <td colspan="2">
                  <bold>Allelic frequencies</bold>
                </td>
                <td>
                  <bold>Test of association</bold>
                </td>
              </tr>
              <tr>
                <td/>
                <td>
                  <bold>Cases</bold>
                </td>
                <td>
                  <bold>Controls</bold>
                </td>
                <td/>
              </tr>
              <tr>
                <td><bold>16 bp insertion</bold>rs59758982</td>
                <td>26.25 %</td>
                <td>27.5 %</td>
                <td>OR = 1.07CI <sub>95%</sub> = (0.57 – 2)p = 0.841</td>
              </tr>
              <tr>
                <td><bold>Arg allele</bold>rs1042522</td>
                <td>31.26 %</td>
                <td>32.8 %</td>
                <td>OR = 0.93CI <sub>95% </sub>= (0.51 – 1.68)p = 0,823</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn id="idm1841765420">
              <label/>
              <p>OR: Odds ratio  </p>
            </fn>
            <fn id="idm1841764988">
              <label/>
              <p>CI: confidence interval</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
    </sec>
    <sec id="idm1841766644" sec-type="discussion">
      <title>Discussion </title>
      <p>Clinical characteristics of Senegalese patients  diagnosed with oral cancers have been described by Touré et al in 2005 and highlighted early age at diagnosis (52.6 years), a sex ratio in favor of females (0.67), a negative alcohol-tobacco status (62.9% non-smokers and 83.8% non-alcoholics) and a poor oral hygiene <xref ref-type="bibr" rid="ridm1842069732">24</xref>. This profile is quite similar to what observed in our patients. These results highlighted that tobacco and alcohol are not the common risk factors and emphasized the hypothesis that exposure to HPV and genetic factors may be associated with oral carcinogenesis in Senegalese population.</p>
      <p>The predominant tumor histology in our patients was squamous cell carcinoma. This type represents 95% of all oral cancers tumors worldwide and is characterized by altered proliferation of dysplastic squamous cells on the surface of the epithelial layer ) <xref ref-type="bibr" rid="ridm1842130540">12</xref>. In mice model, the               introduction of the Arg172His mutation corresponding to human Arg175His, has been associated with the functional inactivation of p63 and p73 proteins <xref ref-type="bibr" rid="ridm1842127156">13</xref><xref ref-type="bibr" rid="ridm1842130540">12</xref>.</p>
      <p>Among oral cancer etiological factors genetic           alterations in specific genes controlling the cell cycle such as <italic>TP53 </italic>have been reported. In this study, 52.27% of              patients carried at least one mutation in <italic>TP53</italic> (46/88), similar to data from Poeta <italic>et al </italic>in the US (53.3%, 224/420) <xref ref-type="bibr" rid="ridm1842046996">29</xref> and Yamamoto <italic>et al</italic> in Japanese patients (49.5%, 91/194) <xref ref-type="bibr" rid="ridm1842058084">30</xref>.</p>
      <p>We identified eleven <italic>TP53</italic> variants in our patients including ten Single Nucleotide Variants (SNV) and one Copy Number Variation (CNV). Among these variants, four have been newly identified in this study. They were not reported in any variant database (ClinVar, dbSNP,              Varsome…). Effect prediction by SIFT and PolyPhen tools showed possible clinical significance of 2 missense                 variants on p53 function (c.62A&gt;C (p.Asp21Ala); c.773A&gt;T (p.Glu258Val)). Further studies are required to assess their functional significance.</p>
      <p>The other seven variants identified in this study have been reported in Clinvar, dbSNP and gnomAD             databases. Two of them are the most frequent (p.Pro72Arg, rs1042522) and the 16 bp insertion (rs59758982). They are both cancer related-variant and their functional impact in p53 have been reported <xref ref-type="bibr" rid="ridm1842123628">14</xref>. The first one (p.Pro72Arg, rs1042522) has been                     extensively studied as a potential risk factor for the               development of malignancies and is the most common variant associated with predisposition to oral cancers. Allelic and genotypic distribution of rs1042522 are known depending on geographic latitude and ethnicity                        throughout the world <xref ref-type="bibr" rid="ridm1842057076">31</xref><xref ref-type="bibr" rid="ridm1842029580">32</xref><xref ref-type="bibr" rid="ridm1842026700">33</xref><xref ref-type="bibr" rid="ridm1842023748">34</xref><xref ref-type="bibr" rid="ridm1842020796">35</xref>. The variant has been               associated in case/control studies with a higher risk of oral, nasopharyngeal, lung, thyroid, skin, cervical, prostate, bladder, gastric, colorectal, and hepatic                                cancers <xref ref-type="bibr" rid="ridm1842106564">20</xref><xref ref-type="bibr" rid="ridm1842019644">36</xref><xref ref-type="bibr" rid="ridm1842013164">37</xref><xref ref-type="bibr" rid="ridm1842010644">38</xref><xref ref-type="bibr" rid="ridm1842008484">39</xref>. Arg72 allele frequency was estimated at 31.26% in our patients, similar to frequencies observed in African and African American populations as reported in gnomAD database (31.4% and 32.1% respectively). In contrast, frequencies reported for Asian and Caucasian populations are higher (58.4% and 73.6% respectively) confirming the ethnic and geographic bias observed in the distribution of this variant throughout the world.</p>
      <p>For the 16 bp insertion in intron 3 (rs59758982), its implication on carcinogenesis has also been highlighted in several cancers: colorectal, breast, cervical, gastric, head and neck, lung, bladder, esophagus, and in                                glaucoma <xref ref-type="bibr" rid="ridm1842106564">20</xref><xref ref-type="bibr" rid="ridm1842036852">40</xref><xref ref-type="bibr" rid="ridm1842136228">15</xref>. Allelic frequency of 12% has been reported in Caucasian diagnosed with colorectal                   cancer <xref ref-type="bibr" rid="ridm1842036852">40</xref> whereas in our study, the frequency was 2 times higher (26.25%). In contrast this variant was not detected in 425 Japanese patients with primary open            angle glaucoma <xref ref-type="bibr" rid="ridm1842035268">41</xref>.</p>
      <p>Association study between these two                          cancer-related variants did not find any significant                    association in our population as we previously reported in a meta-analysis <xref ref-type="bibr" rid="ridm1842091300">19</xref>. However, LD test showed that they are strongly linked and could be transmitted together in a common haplotype predisposing towards oral cancers. It is therefore necessary to study the haplotype structure and investigate the role of neighboring variants spanning intron 3 to intron 4 region, especially intron 4 where an internal promoter encoding nine p53 isoforms has been located.  Mutations in this promoter have been reported to affect the transcription and expression level of p53 isoforms <xref ref-type="bibr" rid="ridm1842106564">20</xref><xref ref-type="bibr" rid="ridm1842033180">42</xref>. Eiholzer and colleagues have recently demonstrated in 2020 that this genomic region harbor several haplotypes blocks that could increase the level of expression of the Δ133_<italic>TP53</italic> transcript, which at certain levels of expression can have pro-tumor effects <xref ref-type="bibr" rid="ridm1841969028">43</xref>. Therefore it would be of interest to investigate by long read target sequencing and functional analysis this                genomic region in patients diagnosed with cancer, and definitely address its implication on carcinogenesis. </p>
    </sec>
    <sec id="idm1841763980" sec-type="conclusions">
      <title>Conclusion </title>
      <p>Our study highlighted that despite the absence of association between the two most common cancer-related variants of TP53 observed in Senegalese patients                 diagnosed with oral cancer, their strong LD suggests that they are transmitted together in a common haplotype and may be implicated in oral carcinogenesis. Further           functional and genomic studies are needed to explore the implication of the genomic region spanning intron 3 to intron 4 of TP53 gene where most cancer-related variants are located.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="ridm1842314268">
        <label>1.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bray</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Ferlay</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Soerjomataram</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>L Siegel</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>A Torre</given-names>
          </name>
          <article-title>(2018)Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.CA</article-title>
          <source>Cancer J</source>
          <volume>68</volume>
          <issue>6</issue>
          <fpage>394</fpage>
          <lpage>424</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842380796">
        <label>2.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>C</surname>
            <given-names>P Freier</given-names>
          </name>
          <name>
            <surname>Stiasny</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Kuhn</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Mayr</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Alexiou</surname>
            <given-names>C</given-names>
          </name>
          <chapter-title>(2016)Immunohistochemical Evaluation of the Role of p53 Mutation in Cervical Cancer: Ser-20 p53-Mutant Correlates with Better Prognosis.Anticancer Res.36(6):</chapter-title>
          <fpage>3131</fpage>
          <lpage>7</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842394116">
        <label>3.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>K</surname>
            <given-names>R Patel</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names>N Vajaria</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>D Singh</given-names>
          </name>
          <name>
            <surname>Begum</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>S</given-names>
          </name>
          <article-title>implications of p53 alterations in oral cancer progression: a review from India.Exp Oncol.40(1):</article-title>
          <date>
            <year>2018</year>
          </date>
          <fpage>10</fpage>
          <lpage>18</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842385836">
        <label>4.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Stiasny</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>P Freier</given-names>
          </name>
          <name>
            <surname>Kuhn</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Schulze</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Mayr</surname>
            <given-names>D</given-names>
          </name>
          <chapter-title>(2017)The involvement of E6, p53, p16, MDM2 and Gal-3 in the clinical outcome of patients with cervical cancer.Oncol Lett.14(4):</chapter-title>
          <fpage>4467</fpage>
          <lpage>4476</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842169076">
        <label>5.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Choi</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>N Myers</given-names>
          </name>
          <article-title>(2008)Molecular pathogenesis of oral squamous cellcarcinoma:implications for therapy.J Dent Res.87(1):</article-title>
          <fpage>14</fpage>
          <lpage>32</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842166772">
        <label>6.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Denaro</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Lo</surname>
            <given-names>Nigro C</given-names>
          </name>
          <name>
            <surname>Natoli</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>E</surname>
            <given-names>G Russi</given-names>
          </name>
          <name>
            <surname>Adamo</surname>
            <given-names>V</given-names>
          </name>
          <chapter-title>(2011)TheRoleof p53 and MDM2 in Head and Neck Cancer.ISRN Otolaryngol.2011:</chapter-title>
          <fpage>931813</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842155572">
        <label>7.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>H</surname>
            <given-names>K Williams</given-names>
          </name>
          <article-title>pathogenesis of oral squamous carcinoma.Mol Pathol.53(4):</article-title>
          <date>
            <year>2000</year>
          </date>
          <fpage>165</fpage>
          <lpage>72</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842152260">
        <label>8.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>L</surname>
            <given-names>G Entiauspe</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>K Seixas</given-names>
          </name>
          <name>
            <surname>E</surname>
            <given-names>M Nunes</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>M Rodrigues</given-names>
          </name>
          <name>
            <surname>O</surname>
            <given-names>A Dellagostin</given-names>
          </name>
          <chapter-title>(2014)Uncommonnon-oncogenicHPVgenotypes, TP53 and MDM2genespolymorphismsin HIV-infectedwomeninSouthernBrazil.Braz J Infect Dis.18(6):</chapter-title>
          <fpage>643</fpage>
          <lpage>50</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842157804">
        <label>9.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Gupta</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Kumar</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names>C Das</given-names>
          </name>
          <chapter-title>(2018)HPV: Molecular pathways and targets.Curr Probl Cancer.42(2):</chapter-title>
          <fpage>161</fpage>
          <lpage>174</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842141108">
        <label>10.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Singh</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Sarkar</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>V Sashidhara</given-names>
          </name>
          <name>
            <surname>Ali</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Sinha</surname>
            <given-names>S</given-names>
          </name>
          <article-title>activity of a novel coumarin-chalcone hybrid is mediated through intrinsic apoptotic pathway by inducing PUMA and alteringBax/Bcl-2 ratio.Apoptosis.19(6):</article-title>
          <date>
            <year>2014</year>
          </date>
          <fpage>1017</fpage>
          <lpage>28</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842146652">
        <label>11.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Zushi</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Narisawa-Saito</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Noguchi</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Yoshimatsu</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Yugawa</surname>
            <given-names>T</given-names>
          </name>
          <article-title>(2011)An in vitromultistepcarcinogenesismodel forbothHPV-positive and -negativehumanoralsquamouscellcarcinomas.Am</article-title>
          <source>J Cancer</source>
          <volume>1</volume>
          <issue>7</issue>
          <fpage>869</fpage>
          <lpage>81</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842130540">
        <label>12.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Monti</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Menichini</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Speciale</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Cutrona</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Fais</surname>
            <given-names>F</given-names>
          </name>
          <chapter-title>(2020)Heterogeneityof TP53 Mutations and P53ProteinResidualFunctioninCancer:DoesItMatter?Front Oncol.10:</chapter-title>
          <fpage>593383</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842127156">
        <label>13.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Alvarado-Ortiz</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>G</surname>
            <given-names>de la Cruz-Lopez K</given-names>
          </name>
          <name>
            <surname>Becerril-Rico</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Sarabia-Sanchez</given-names>
          </name>
          <name>
            <surname>Ortiz-Sanchez</surname>
            <given-names>E</given-names>
          </name>
          <chapter-title>(2020)Mutant p53 Gain-of-Function:Rolein CancerDevelopment, Progression, andTherapeuticApproaches.Front Cell Dev Biol.8:</chapter-title>
          <fpage>607670</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842123628">
        <label>14.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Bouaoun</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Sonkin</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Ardin</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Hollstein</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Byrnes</surname>
            <given-names>G</given-names>
          </name>
          <chapter-title>(2016)TP53 Variations in Human Cancers: New Lessons from the IARC TP53 Database and Genomics Data.Hum Mutat.37(9):</chapter-title>
          <fpage>865</fpage>
          <lpage>76</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842136228">
        <label>15.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Gemignani</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Moreno</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Landi</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Moullan</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Chabrier</surname>
            <given-names>A</given-names>
          </name>
          <article-title>(2004)A TP53polymorphismisassociatedwithincreasedriskof colorectal cancer andwithreducedlevelsof TP53mRNA.Oncogene.23(10):</article-title>
          <fpage>1954</fpage>
          <lpage>6</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842131692">
        <label>16.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Barnoud</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Parris</surname>
            <given-names>J L D</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>E</given-names>
          </name>
          <article-title>(2019)Common genetic variants in the TP53 pathway and their impact on cancer.J Mol Cell Biol.11(7):</article-title>
          <fpage>578</fpage>
          <lpage>585</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842101884">
        <label>17.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>M</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Liu</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Yao</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Huo</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Liu</surname>
            <given-names>Q</given-names>
          </name>
          <article-title>(2017)A functionally significant</article-title>
          <chapter-title>SNP in TP53 and breast cancer risk in African-American women.NPJ Breast Cancer.3:</chapter-title>
          <fpage>5</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842097348">
        <label>18.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Scheckenbach</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Lieven</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Gotte</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Bockmuhl</surname>
            <given-names>U</given-names>
          </name>
          <name>
            <surname>Zotz</surname>
            <given-names>R</given-names>
          </name>
          <article-title>(2004)p53 codon 72 polymorphic variants, loss of allele-specific transcription, and human papilloma virus 16 and/or 18 E6 messenger RNAexpression in squamous cell carcinomas of the head and neck.Cancer Epidemiol Biomarkers</article-title>
          <chapter-title>Prev.13(11 Pt 1):</chapter-title>
          <fpage>1805</fpage>
          <lpage>9</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842091300">
        <label>19.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>P</surname>
            <given-names>D Sarr</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>A Ba</given-names>
          </name>
          <name>
            <surname>Touré</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Diop</surname>
            <given-names>J P D</given-names>
          </name>
          <name>
            <surname>DIA</surname>
            <given-names>Y</given-names>
          </name>
          <chapter-title>(2020)Association of the TP53 Arg72ProPolymorphismwithOralSquamousCellCarcinoma:A Meta-Analysis.J Mol Genet Med.14(3)</chapter-title>
        </mixed-citation>
      </ref>
      <ref id="ridm1842106564">
        <label>20.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bellini</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Pitto</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Porcu</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Moi</surname>
            <given-names>P</given-names>
          </name>
          <article-title>expressionlevelsin relation to haplotypes of the TP53internalpromoterregion.Hum Mutat.31(4):</article-title>
          <date>
            <year>2010</year>
          </date>
          <fpage>456</fpage>
          <lpage>65</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842080172">
        <label>21.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>S</surname>
            <given-names>J Diskin</given-names>
          </name>
          <name>
            <surname>Capasso</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Diamond</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>A Oldridge</given-names>
          </name>
          <name>
            <surname>Conkrite</surname>
            <given-names>K</given-names>
          </name>
          <chapter-title>(2014)Rare variants in TP53 and susceptibility to neuroblastoma.J Natl Cancer Inst.106(4):</chapter-title>
          <fpage>047</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842078444">
        <label>22.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ndiaye</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Dem</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>M Mbaye</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>M Gueye</given-names>
          </name>
          <name>
            <surname>Diop</surname>
            <given-names>G</given-names>
          </name>
          <article-title>(2014)[Study of codon 72 of p53 gene as a risk-factor in cervical cancer in Senegal].Bull Cancer.101(9):</article-title>
          <fpage>789</fpage>
          <lpage>94</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842073332">
        <label>23.</label>
        <mixed-citation xlink:type="simple" publication-type="journal"><article-title>Abbara A.Statistiques médicales et épidémiologiques : Outil de calcul médico-statistique permettant l&amp;apos;évaluation des indicateurs de risque et la liaison entre un facteur d&amp;apos;exposition et une maladie.2021</article-title><date><year>2021</year></date>
Available from:http://www.aly-abbara.com/utilitaires/statistiques/khi_carre_rr_odds_ratio_ic.html



</mixed-citation>
      </ref>
      <ref id="ridm1842069732">
        <label>24.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Touré</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Sonko</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Diallo</surname>
            <given-names>B-K</given-names>
          </name>
          <name>
            <surname>Diop</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Diop</surname>
            <given-names>A</given-names>
          </name>
          <article-title>(2005)Profil épidémiologique des cancers de la cavité buccale au Sénégal.Rev Stomatol Chir Maxillofac.17</article-title>
        </mixed-citation>
      </ref>
      <ref id="ridm1842068724">
        <label>25.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>F</surname>
            <given-names>R Pires</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>B Ramos</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>B Oliveira</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>S Tavares</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>S Luz</given-names>
          </name>
          <article-title>casesfroma single oralpathologyserviceduringan 8-yearperiod.J Appl Oral Sci.21(5):</article-title>
          <date>
            <year>2013</year>
          </date>
          <fpage>460</fpage>
          <lpage>7</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842081108">
        <label>26.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Rivera</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Venegas</surname>
            <given-names>B</given-names>
          </name>
          <article-title>and molecular aspects of oral squamous cell carcinoma (Review).Oncol Lett.8(1):</article-title>
          <date>
            <year>2014</year>
          </date>
          <fpage>7</fpage>
          <lpage>11</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842052828">
        <label>27.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ara</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Atique</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Ahmed</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>G</surname>
            <given-names>Ali Bukhari S</given-names>
          </name>
          <article-title>of p53 gene mutation and protein expression in oral squamous cell carcinoma.J Coll Physicians Surg Pak.24(10):</article-title>
          <date>
            <year>2014</year>
          </date>
          <fpage>749</fpage>
          <lpage>53</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842050524">
        <label>28.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>E</surname>
            <given-names>A Martinez</given-names>
          </name>
          <name>
            <surname>Jiménez-Gomez</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Medina</surname>
            <given-names>C M A</given-names>
          </name>
          <article-title>(2013)Immunoexpressionof p53in Oral Squamous Cell Carcinoma and Oral Dysplastic Lesions in Patients with the Habit of Reverse Smoke.Int</article-title>
          <source>J</source>
          <volume>7</volume>
          <issue>2</issue>
          <fpage>7</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842046996">
        <label>29.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>L Poeta</given-names>
          </name>
          <name>
            <surname>Manola</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Goldwasser</given-names>
          </name>
          <name>
            <surname>Forastiere</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Benoit</surname>
            <given-names>N</given-names>
          </name>
          <article-title>(2007)TP53 mutations and survival in squamous-cell carcinoma of the head and neck.N</article-title>
          <source>Engl J</source>
          <volume>357</volume>
          <issue>25</issue>
          <fpage>2552</fpage>
          <lpage>61</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842058084">
        <label>30.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Yamamoto</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Kanai</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Kou</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Sugiyama</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Nakamura</surname>
            <given-names>E</given-names>
          </name>
          <article-title>(2020)Clinicalsignificanceof TP53 variants as possiblesecondaryfindingsintumor-onlynext-generationsequencing.J Hum Genet.65(2):</article-title>
          <fpage>125</fpage>
          <lpage>132</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842057076">
        <label>31.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Beckman</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Birgander</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Sjalander</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Saha</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>A Holmberg</given-names>
          </name>
          <article-title>p53 polymorphism maintained by natural selection?Hum Hered.44(5):</article-title>
          <date>
            <year>1994</year>
          </date>
          <fpage>266</fpage>
          <lpage>70</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842029580">
        <label>32.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Brant</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Hoffmann</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Kanappilly</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Gorogh</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Gottschlich</surname>
            <given-names>S</given-names>
          </name>
          <article-title>codon 72polymorphismin squamous cell carcinoma of the head and neck region.Anticancer Res.27(5A):</article-title>
          <date>
            <year>2007</year>
          </date>
          <fpage>3301</fpage>
          <lpage>5</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842026700">
        <label>33.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Fuentes</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Pulgar</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Gallo</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>C Bortolini</given-names>
          </name>
          <name>
            <surname>Canizales-Quinteros</surname>
            <given-names>S</given-names>
          </name>
          <article-title>(2014)[Gene geography of Chile: regional distribution of American</article-title>
          <chapter-title>European and African genetic contributions].Rev Med Chil.142(3):</chapter-title>
          <fpage>281</fpage>
          <lpage>9</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842023748">
        <label>34.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Kashima</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Makino</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Soemantri</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Ishida</surname>
            <given-names>T</given-names>
          </name>
          <chapter-title>(2007)TP53 codon 72polymorphismin 12 populations of insular Southeast Asia and Oceania.J Hum Genet.52(8):</chapter-title>
          <fpage>694</fpage>
          <lpage>7</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842020796">
        <label>35.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Sjalander</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Birgander</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Saha</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Beckman</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Beckman</surname>
            <given-names>G</given-names>
          </name>
          <article-title>polymorphisms and haplotypes show distinct differences between major ethnic groups.Hum Hered.46(1):</article-title>
          <date>
            <year>1996</year>
          </date>
          <fpage>41</fpage>
          <lpage>8</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842019644">
        <label>36.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Isakova</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Talaibekova</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Aldasheva</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Vinnikov</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Aldashev</surname>
            <given-names>A</given-names>
          </name>
          <article-title>(2017)The association of polymorphic markers</article-title>
          <chapter-title>Arg399Gln of XRCC1 gene, Arg72Pro of TP53 gene and T309G of MDM2 gene with breast cancer in Kyrgyz females.BMC Cancer.17(1):</chapter-title>
          <fpage>758</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842013164">
        <label>37.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>S Khan</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names/>
          </name>
          <name>
            <surname>S</surname>
            <given-names>R Masoodi</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>H Khan</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>A Rather</given-names>
          </name>
          <article-title>(2015)Significant association of TP53 Arg72Pro polymorphism in susceptibility to differentiated thyroid cancer.Cancer Biomark.15(4):</article-title>
          <fpage>459</fpage>
          <lpage>65</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842010644">
        <label>38.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>J</surname>
            <given-names>Z Peng</given-names>
          </name>
          <name>
            <surname>Xue</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>G Liu</given-names>
          </name>
          <name>
            <surname>Y</surname>
            <given-names>H Lin</given-names>
          </name>
          <chapter-title>(2015)Association of the p53 Arg72Pro polymorphism withesophagealcancer in Chinesepopulations:a meta-analysis.Genet Mol Res.14(3):</chapter-title>
          <fpage>9024</fpage>
          <lpage>33</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842008484">
        <label>39.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Zhang</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Zhao</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Sun</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Dong</surname>
            <given-names>Q</given-names>
          </name>
          <chapter-title>(2018)Associationbetweenp53 Arg72Propolymorphismand colorectal cancerriskin Asianpopulation:ameta-analysis.Curr Probl Cancer.42(6):</chapter-title>
          <fpage>582</fpage>
          <lpage>592</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842036852">
        <label>40.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Bottari</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Landi</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Gemignani</surname>
            <given-names>F</given-names>
          </name>
          <article-title>tube genotyping of GSTM1</article-title>
          <date>
            <year>2006</year>
          </date>
          <chapter-title>GSTT1 and TP53 polymorphisms by multiplex PCR.DNA Seq.17(5):</chapter-title>
          <fpage>396</fpage>
          <lpage>9</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842035268">
        <label>41.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Mabuchi</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Sakurada</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Kashiwagi</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Yamagata</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Iijima</surname>
            <given-names>H</given-names>
          </name>
          <article-title>(2009)Lack of association between p53 gene polymorphisms and primary open angle glaucoma in the Japanese population.Mol Vis.15:</article-title>
          <fpage>1045</fpage>
          <lpage>9</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1842033180">
        <label>42.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>J</surname>
            <given-names>D Wall</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>K Pritchard</given-names>
          </name>
          <article-title>blocks and linkage disequilibrium in the human genome.Nat Rev Genet.4(8):</article-title>
          <date>
            <year>2003</year>
          </date>
          <fpage>587</fpage>
          <lpage>97</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1841969028">
        <label>43.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>R</surname>
            <given-names>A Eiholzer</given-names>
          </name>
          <name>
            <surname>Mehta</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Kazantseva</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>J Drummond</given-names>
          </name>
          <name>
            <surname>McKinney</surname>
            <given-names>C</given-names>
          </name>
          <chapter-title>(2020)IntronicTP53PolymorphismsAre AssociatedwithIncreasedDelta133TP53Transcript, Immune Infiltration and Cancer Risk.Cancers (Basel).12(9)</chapter-title>
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>
