<?xml version="1.0" encoding="utf8"?>
 <!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.0 20120330//EN" "http://jats.nlm.nih.gov/publishing/1.0/JATS-journalpublishing1.dtd"> <article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.0" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">JVHC</journal-id>
      <journal-title-group>
        <journal-title>Journal of Veterinary Healthcare</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2575-1212</issn>
      <publisher>
        <publisher-name>Open Access Pub</publisher-name>
        <publisher-loc>United States</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.14302/issn.2575-1212.jvhc-21-4034</article-id>
      <article-id pub-id-type="publisher-id">JVHC-21-4034</article-id>
      <article-categories>
        <subj-group>
          <subject>research-article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Cytokine Expression in Peripheral Blood Mononuclear Cell Cultures Obtained from Cattle with Different Stages of Natural <italic>Mycobacterium</italic> <italic>bovis</italic> Infection </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Lugo-Arriaga,</surname>
            <given-names>María Teresa</given-names>
          </name>
          <xref ref-type="aff" rid="idm1849705676">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Jaramillo-Meza,</surname>
            <given-names>Laura</given-names>
          </name>
          <xref ref-type="aff" rid="idm1849704740">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Manzo-Sandoval,</surname>
            <given-names>Anabelle</given-names>
          </name>
          <xref ref-type="aff" rid="idm1849704740">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Díaz-Otero,</surname>
            <given-names>Fernando</given-names>
          </name>
          <xref ref-type="aff" rid="idm1849704740">1</xref>
          <xref ref-type="aff" rid="idm1849705532">*</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1849704740">
        <label>1</label>
        <addr-line>CENID-Salud Animal e Inocuidad. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Carretera México-Toluca, Km. 15.5, C.P. 05110, Ciudad de México, México.</addr-line>
      </aff>
      <aff id="idm1849705676">
        <label>2</label>
        <addr-line>Medicina Veterinaria y Zootecnia, Facultad de Estudios Superiores Cuautitlán Campo 4, UNAM, Carretera              Cuautitlán-Teoloyucan Km. 2.5, San Sebastián Xhala 54714 Cuautitlán Izcalli, Estado de México.</addr-line>
      </aff>
      <aff id="idm1849705532">
        <label>*</label>
        <addr-line>Corresponding author</addr-line>
      </aff>
      <contrib-group>
        <contrib contrib-type="editor">
          <name>
            <surname>Yanzhou</surname>
            <given-names>Yang</given-names>
          </name>
          <xref ref-type="aff" rid="idm1849552412">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1849552412">
        <label>1</label>
        <addr-line>Ningxia Medical University </addr-line>
      </aff>
            <author-notes>
        <corresp>
          Fernando Díaz-Otero
          <addr-line>Departamento de Inmunología, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Carretera México-Toluca Km 15.5, Col. Palo Alto, México</addr-line>
          <phone>+52 (55) 3871 8700 ext. 80315</phone>
          <email>diof0009@yahoo.com.mx</email>
        </corresp>
        <fn fn-type="conflict" id="idm1842749932">
          <p>The authors have declared that no competing interests exist.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub" iso-8601-date="2021-12-16">
        <day>16</day>
        <month>12</month>
        <year>2021</year>
      </pub-date>
      <volume>2</volume>
      <issue>4</issue>
      <fpage>26</fpage>
      <lpage>41</lpage>
      <history>
        <date date-type="received">
          <day>30</day>
          <month>11</month>
          <year>2021</year>
        </date>
        <date date-type="accepted">
          <day>14</day>
          <month>12</month>
          <year>2021</year>
        </date>
        <date date-type="online">
          <day>16</day>
          <month>12</month>
          <year>2021</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© </copyright-statement>
        <copyright-year>2021</copyright-year>
        <copyright-holder>Lugo-Arriaga, María Teresa, et al.</copyright-holder>
        <license xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="http://openaccesspub.org/jvhc/article/1745">This article is available from http://openaccesspub.org/jvhc/article/1745</self-uri>
      <abstract>
        <p>In bovine tuberculosis (bTB), cellular,                    humoral, or both types of immune responses have been observed. The purpose of this study was to                examine the immune status of tuberculous cows based on the differential cytokine gene expression                        associated with Th1 (IFN-γ, IL-2), or Th2 (IL-4,            IL-10) responses. Twenty-three (23) cows belonging to a dairy herd located in a rural region of the State of Hidalgo, México, were selected for the study. Single Intradermal Comparative Cervical Tuberculin (SICCT) Test, Interferon-Gamma (IFN-γ) Release Assay (BOVIGAM), and Enzyme-Linked Immunosorbent               Assay (ELISA) were used for detection of cattle              infected by <italic>M. </italic><italic>bovis</italic>. Thirteen cows were positive to all the tests (Group 1); ten cows were positive only to ELISA (Group 2), and the remaining Group (Group 3, control) included cows negative to all the tests.              Peripheral blood mononuclear cells (PBMC) from               animals were <italic>in vitro</italic> stimulated by bovin purified protein derivative (PPD), avian PPD, and Concanavalin A (Con A) mitogen for 72h. Changes in the levels of                           expression of mRNA of the respective cytokines was                measured by Reverse Transcription-Polymerase Chain Reaction (RT-PCR) using β-actin gene as internal control. In group 1, PPD bovis and Con A-stimulated cells exhibited high production of IFN-γ, IL-2 and IL-4, but not IL-10. In contrast, PPD avium-stimulated cells displayed a low                    production of cytokine transcripts. In group 2, cells showed a significant production of IL-10 in response to bovine PPD (<italic>P</italic>&lt; 0.001). In the control group, a high                    production of IFN-γ and IL-2 was observed only in Con             A-stimulated cells. Post-mortem examinations in animals of group 1 showed slight and medium lesions in lymph nodes, whereas in group 2, the lesions were more                    extensive. Results indicate differences on gene expression levels of cytokines considered to determine balance in Th1/Th2 response among the evaluated groups. In                 addition, high levels of antibodies against <italic>M. </italic><italic>bovis</italic> and high IL-10 expression in PBMC together are indicators of progressive bTB when both tuberculin test and IFN-γ        assay are negative in tuberculous anergic cattle.  Inclusion of serology and IL-10 cytokine expression in in the                  diagnosis checklist improves detection of infected cattle to help control bovine tuberculosis.</p>
      </abstract>
      <kwd-group>
        <kwd>Tuberculosis</kwd>
        <kwd>Mycobacteriumbovis</kwd>
        <kwd>cytokines</kwd>
        <kwd>peripheral blood mononuclear cells</kwd>
        <kwd>natural infection</kwd>
        <kwd>cattle.</kwd>
      </kwd-group>
      <counts>
        <fig-count count="2"/>
        <table-count count="3"/>
        <page-count count="25"/>
      </counts>
    </article-meta>
  </front>
  <body>
    <sec id="idm1849527844" sec-type="intro">
      <title>Introduction </title>
      <p>Bovine Tuberculosis (bTB) is a contagious,               chronic bacterial disease caused by <italic>Mycobacterium </italic><italic>bovis</italic> (<italic>M. </italic><italic>bovis</italic>), with worldwide distribution <xref ref-type="bibr" rid="ridm1844802980">1</xref>. The disease has a negative impact on the livestock industry and it                       represents a risk to human health <xref ref-type="bibr" rid="ridm1844804996">2</xref>. The progress or                  containment of the infection depends on the dynamic             nature established between host immune response cells and the <italic>M. </italic><italic>bovis</italic> bacterium. Cellular immunity, mediated by CD4+ T lymphocytes, involving cytokines that increase the microbicide activity of macrophages, play a significant role in the elimination of bacteria <xref ref-type="bibr" rid="ridm1844812420">3</xref>. Interferon gamma (IFN-γ), a pro-inflammatory cytokine seems to be the most critical effector molecule for the activation of the                      phagocytic cells, because it mediates its protective efficacy through the induction of reactive oxygen and nitrogen intermediates, necessary for the destruction of                         intracellular mycobacteria <sup>4, 5</sup>. Hence, the measuring of IFN-γ level in whole-blood culture supernatant has been a diagnostic test widely used to identify tuberculous cattle from decades ago <xref ref-type="bibr" rid="ridm1844663172">6</xref><xref ref-type="bibr" rid="ridm1844651676">7</xref><xref ref-type="bibr" rid="ridm1844654916">8</xref>. Diverse studies have shown that a protective immune response is not only associated to                 IFN-γ but also to tumor necrosis factor-α (TNF-α) and     interleukin (IL)-2 produced by memory T cells <xref ref-type="bibr" rid="ridm1844640732">9</xref><xref ref-type="bibr" rid="ridm1844641524">10</xref><xref ref-type="bibr" rid="ridm1844632708">11</xref>.                    Nevertheless, the production of IFN-γ and IL-2 is                      accompanied by synthesis of IL-4 and IL-10 after a <italic>M. </italic><italic>bovis</italic>-challenge in BCG-vaccinated cattle <xref ref-type="bibr" rid="ridm1844627020">12</xref>. Some authors have shown that IL-10 regulates a strong                                      pro-inflammatory immune response, which contributes to host-induced tissue harm <xref ref-type="bibr" rid="ridm1844627020">12</xref>,<xref ref-type="bibr" rid="ridm1844625292">13</xref>. On the other hand, both tuberculin skin test and Interferon-Gamma (IFN-γ)                   Release Assay (BOVIGAM) are important to detect                    bTB-suspected cattle at onset and during the primary               infection, but as the disease progresses, a decrease in the cell-mediated immune response take place concomitantly with an increase of antibodies to <italic>M. </italic><italic>bovis</italic><xref ref-type="bibr" rid="ridm1844812420">3</xref>. Detection of serum antibodies to the pathogen is an alternative test that has been proposed to improve the sensitivity of bTB diagnosis in cattle <xref ref-type="bibr" rid="ridm1844623348">14</xref>. However, the scarcity of                             understanding concerning the immunological mechanisms in <italic>M. </italic><italic>bovis</italic> infection in cattle has forced the search for               biomarkers. In this sense, PPD bovis-stimulated                      peripheral blood mononuclear cells (PBMC) from <italic>M.                 </italic><italic>bovis</italic>-infected animals with high pathology showed an increase in expression of transcripts to pro-inflammatory cytokines than did animals with low pathology <xref ref-type="bibr" rid="ridm1844658564">5</xref>.                   Therefore, this study aimed to examine the immunological status of tuberculous cows with different reactivity to         immunodiagnostic tests of tuberculin skin test, IFN-γ               assay (BOVIGAM), and ELISA to anti-<italic>M. </italic><italic>bovis</italic> antibodies by measuring transcripts to cytokines IFN-γ, IL-2, IL-4, and IL-10 in PBMC culture, and their correlation with                        postmortem inspection.</p>
    </sec>
    <sec id="idm1849509300" sec-type="materials">
      <title>Materials and Methods</title>
      <sec id="idm1849510740">
        <title>Reagents </title>
        <p>Bovine- and avian-PPD were purchased from PRONABIVE (Mexico City, Mexico). Ficoll-hypaque was acquired from Amersheim Biosciences (Uppasala,                    Sweden). The kit for the detection of bovine gamma                 interferon was from BOVIGAM™ (Applied Biosystems™ Thermo Fisher Scientific). RPMI-1640 culture medium, peroxidase-labeled protein G, <italic>L</italic>-glutamine,                              <italic>ortho</italic>-phenylendiamine, <italic>t</italic>-octylphenoxy polyeth                   oxyethanol (Triton X-100), polyoxyethylenesorbitan monolaurate (Tween 20), <italic>Canavalia </italic><italic>ensiformis</italic> (Concanavalin A, Con A), ethidium bromide, and                                2-mercaptoethanol were from Sigma Aldrich (St. Louis, MO, USA). TRIzol reagent, RNase inhibitor, dithiothreitol (DTT), recombinant DNase I (RNase-free), ampliTaq DNA polymerase, superScript III reverse transcriptase, and     deoxyribonucleotides were acquired from Invitrogen Life Technologies (Carlsbad, CA, USA). Diethyl-pyrocarbonate (DEPC) was from Amresco Inc. (Solon, OH, USA). AmpliTaq DNA polymerase and oligo-d(T)<sub>16 </sub>were from Applied             Biosystems Inc. (Hammonton NJ, USA). Chloroform and             2-propanol were acquired from Merck Chemicals Inc. (Gibbstown, NJ, USA). Sulfuric acid and salts were from JT. Baker Inc (Phillipsburg, NJ, USA).</p>
      </sec>
      <sec id="idm1849507788">
        <title>Ethic Statement</title>
        <p>The study design and sampling methodology were approved by Bioethics Committee for care and                reasonable use of experimental animals in research                projects of the Centro Nacional de Investigación                        Disciplinaria en Salud Animal e Inocuidad (CENID-SAI) belonging to the National Institute for Forestry,                         Agriculture and Livestock Research (INIFAP) in Mexico City, Mexico. Permission to perform the fieldwork was also obtained from CENID-SAI and INIFAP. Collection of blood samples and Single Intradermal Comparative Tuberculin (SICCT) test were performed by qualified veterinarians following official procedures from the Norma Oficial                 Mexicana (NOM-041-ZOO1995) of the National Campaign against tuberculosis in Animals <xref ref-type="bibr" rid="ridm1844617660">15</xref>.  </p>
      </sec>
      <sec id="idm1849508292">
        <title>Animals and Experimental Design </title>
        <p>The study was conducted in a Holstein-Friesian dairy herd located in a rural region of the State of Hidalgo, México, bTB is endemic in the region. In a first field work session, the SICCT test was applied to all the animals of the herd. The same day blood samples were taken from all animals to carry out Enzyme-Linked Immunosorbent               Assay (ELISA) to evaluate immune humoral response against <italic>M. </italic><italic>bovis</italic>-antigens. The following week, after SICCT and ELISA tests were carried out and results obtained, heparinized blood samples were taken from reactor cows and cows with high antibody titers, as well as from                non-reactor cows, but which showed high titers of                 antibodies to mycobacterial antigens, to perform the               Interferon-Gamma (IFN-γ) Release Assay (BOVIGAM).  Based on the results obtained in the three diagnostic tests, twenty-three cows were selected and grouped, as:                  Thirteen, positive to all the mentioned tests, formed  Group 1; the other ten cows, that were only positive to ELISA, formed Group 2. A third Group included ten healthy cows, and tested negative by all the three diagnostic                       tests, served as control. The latter came from a bTB-free accredited herd.  For the purpose of analysis of mRNA      relative expression of IFN-γ, IL-2, IL-4, and IL-10 in PBMC culture of the animal groups, blood samples were                        collected into tubes containing sodium heparin                         anticoagulant (BD Vacutainer, Franklin Lakes NJ, USA). PBMC were isolated by Ficoll-Hypaque (GE Healthcare Ficoll-Paque™ PLUS Media (density 1.077 g/mL)) density gradient centrifugation for its subsequent <italic>in vitro</italic>                   stimulation with bovine PPD (20 μg/ml) and with the              mitogen Concanavalina A.</p>
      </sec>
      <sec id="idm1849515492">
        <title>Single Intradermal Comparative Cervical Tuberculin (SICCT) test.</title>
        <p>Intradermal inoculation of bovine PPD and avian PPD in two sites 12 cm apart on the cow mid-neck was performed.  The first site was injected 100 µl containing 3,250 IU/ml bovine PPD and the second site was injected with 100 µl containing 5,000 IU/ml avian PPD. The skin thickness was measured by a digital Vernier caliper before the intradermal injection and at 72 h later. The results were recorded as an increase in skin thickness at 72 h compared to the thickness pre-injection. Values of both, avian and bovine PPD were plotted.  According to the              official graphic of the Mexican Official Norm, the result was the value at the intersection of avian and bovine PPD values <xref ref-type="bibr" rid="ridm1844617660">15</xref>.</p>
      </sec>
      <sec id="idm1849515276">
        <title>Interferon Gamma Release Assay</title>
        <p>Heparinized whole blood samples were                individually processed within 2–3 h after collection. They were distributed in 1.5 ml aliquots into four individual wells per animal in sterile flat-bottomed 24-well cell               culture plate (Nunclon, Roskilde, Denmark). The first well of the different cultures was stimulated with 20 mg/ml bovine PPD, the second with 20 mg/ml avian PPD, the third with 10 mg/ml polyclonal mitogen Con A, and the fourth well was used as control without stimulation. Blood cultures were incubated at 37°C in a 5% CO<sub>2</sub> humidified atmosphere for 24 h. After this time, the supernatant                 plasma was harvested and stored at -70°C until analyzed. The IFN-γ levels in the plasma supernatants were                   measured using a sandwich ELISA following the                      instructions from a commercial kit (Applied Biosystems™ Bovigam™ Tb Kit, Thermo Fisher Scientific) <xref ref-type="bibr" rid="ridm1844605828">16</xref>. Absorbance of standards and plasma samples were read at 450 nm using an ELISA plate reader (Benchmark-Plus Microplate Spectrophotometer Bio-Rad Laboratories, Hercules CA, USA). Results were evaluated considering the optical                 density at 450 nm (OD<sub>450</sub>) mean value of stimulated                  plasma samples. An animal was positive to the test if value to bovine PPD OD<sub>450</sub> minus value to avian PPD OD<sub>450</sub> were &gt;0.1 OD, and a value for the OD<sub>450</sub> with bovine PPD minus the OD<sub>450</sub> nil antigen culture of  &gt;0.1.</p>
      </sec>
      <sec id="idm1849512684">
        <title>Mycobacterium bovis Culture-Filtrate Protein Extract</title>
        <p>Culture-filtrate protein extracts (CFPE) was                 prepared from <italic>M. </italic><italic>bovis</italic> strain AN5 and <italic>M. avium</italic> strain D4. The bacterial were cultured individually at 37°C for over six weeks in modified Dorset-Henley liquid synthetic               medium <xref ref-type="bibr" rid="ridm1844604028">17</xref>. At the completion of the incubation period, proteins from the cultures filtrates were precipitated by ammonium sulfate [(NH<sub>4</sub>)<sub>2</sub> SO<sub>4</sub>] at a final saturation of 80%, at 4°C for 24h in constant agitation<xref ref-type="bibr" rid="ridm1844602372">18</xref>. Then, the                    solution was centrifuged at 15,000 <italic>g</italic> for 60 min at 4°C, the pellet was suspended in 10 ml of phosphate buffered              saline pH 7.2 (PBS) and dialyzed against PBS using dialysis bags with MW cutoff point from 10 kDa (Cellu.Sep H1, Membrane Filtration Products, Inc. Seguin TX, USA) at 4°C for 36h. Protein concentration in the CFPE was                         determined by the Bradford method <xref ref-type="bibr" rid="ridm1844599780">19</xref>, and it was                     adjusted to 3.5 mg/ml and divided into aliquots of 1 ml, which were stored at -70°C until used.</p>
      </sec>
      <sec id="idm1849497236">
        <title>Comparative ELISA for Determination of Ig-G Class                    Antibodies to Mycobacterium bovis </title>
        <p>A comparative ELISA was carried out using CFPE from <italic>M. </italic><italic>bovis</italic> and <italic>M. avium</italic> antigens separately to assess IgG-class antibodies to <italic>M. </italic><italic>bovis</italic> in serum. <xref ref-type="bibr" rid="ridm1844595748">20</xref>.                             Ninety-six-well flat-bottom ELISA plates (Nunclon,                   Denmark) were incubated with 5 mg/well of either CFPE from <italic>M. </italic><italic>bovis</italic> or <italic>M. avium</italic> diluted in 0.1 M carbonate/bicarbonate buffer of pH 9.6 at 4°C for 24h.                               Antigen-coated ELISA plates were washed 3 times by 0.3% Triton X-100 in PBS (PBS-Triton), 3 times by 0.1%                  Tween-20 in PBS (PBS-Tween) and blocked in 200ml of a blocking buffer (3 % skim milk in PBS-Tween) with                    incubation for 1h at 37°C. After 6 washes in PBS-Tween, 100 µl blood serum (diluted 1:100 in blocking buffer) was added in each well and incubated for 1h at 37°C. The                 ELISA plates were washed again and 100 ml                           peroxidase-labeled protein G diluted 1:10,000 in blocking buffer was added per well, with incubation for 1h at 37°C. Another stage of washes was performed and subsequently 100 µl chromogenic substrate solution containing 0.04%    O-phenylenediamine (Sigma P-3804) and 0.04% of                 hydrogen peroxide in citrate buffer pH 4.5 was added for detection of enzyme reaction. Reaction was stopped with 50 μl/well of 2 M sulfuric acid. Optical densities were                obtained at 492 nm (OD<sub>492nm</sub>) using an automated ELISA plate reader (Benchmark-Plus Microplate                                     Spectrophotometer). All assays were carried out in                  duplicate. Antibody response to <italic>M. </italic><italic>bovis</italic> or <italic>M. </italic><italic>avium</italic> CFPE was established previously by setting the cutoff value of the mean OD<sub>492</sub> plus two standard deviations of sera from healthy animals. </p>
      </sec>
      <sec id="idm1849492628">
        <title>Culture of Peripheral Blood Mononuclear Cells (PBMC)</title>
        <p>PBMC were isolated from bovine blood sample collected using heparin as anticoagulant. For this, 6 ml of blood was diluted 1:2 in PBS, carefully placed over 2.5 ml of Ficoll-Hypaque gradient in a 15 ml centrifuge tube, and centrifuged at 1,600 <italic>g</italic> for 40 min at room temperature <xref ref-type="bibr" rid="ridm1844607700">21</xref>. The mononuclear cell layer was isolated and washed twice in RPMI-1640 culture medium by centrifugation at 440 <italic>g</italic> for 10 minutes. PBMC (5 x 10<sup>6</sup>) were placed into each well of a 24-wells flat-bottom culture plate (Nunclon Denmark) and suspended in 1 ml RPMI-1640 culture medium                 supplemented with 10 mM HEPES buffer, 50 mM                           2-mercaptoethanol, 2 mM <italic>L</italic>-glutamine, 100 U/ml                   penicillin, 0.1 mg/ml streptomycin, and 10%                              heat-inactivated fetal calf serum. Twenty mg/ml bovine PPD,  20 mg/ml avian PPD and 10 mg/ml Con A were               added to the corresponding wells, and incubated for 72 h at 37°C in a 5% CO<sub>2</sub> humidified atmosphere. Cells without antigen stimulation were used as negative control. At the end of the incubation period, the cells, were harvested and washed in RPMI-1640 medium by centrifugation at 440 <italic>g</italic> for 3 min at 4°C discarding supernatant before RNA               extraction.</p>
      </sec>
      <sec id="idm1849490612">
        <title>RNA Extraction</title>
        <p>Total RNA from bovine PPD- or avian PPD- or Con A-stimulated PBMC and control without stimulus were extracted as described <xref ref-type="bibr" rid="ridm1844587932">22</xref>. After RPMI-1640 medium              washing, cells (5 x 10<xref ref-type="bibr" rid="ridm1844663172">6</xref>) were incubated in 1 ml of TRIzol for 5 minutes at room temperature. A second incubation was performed in 200 ml chloroform for 3 min at 4°C.   After centrifugation at 12,000 <italic>g</italic> for 15 minutes at 4°C, the aqueous phase was recovered and RNA was precipitated by incubation 10 minutes in 500 ml 2-propanol. The pellet was centrifuged at 12,000 <italic>g</italic> for 10 min at 4° C, next             suspended in 1 ml 75% ethanol and centrifuged at 7,500 <italic>g</italic>/5 min/4°C. Subsequently, the RNA was suspended in 50 ml of DEPC water and heated for 10 minutes at 55°C. The extracted RNA was measured in a fluorometer (VersaFluor<sup>TM</sup>Fluorometer System Bio-Rad, Richmond CA, USA). To eliminate any genomic DNA contamination, a recombinant DNase I, RNase-free was used to treat the extracted RNA.</p>
      </sec>
      <sec id="idm1849489100">
        <title>Cytokine Transcripts</title>
        <p>The reverse transcriptase-polymerase chain                reaction (RT-PCR) technique was used to evaluate                   cytokine transcript expression by specific primers for         amplification of each one of them [23-27 (<xref ref-type="table" rid="idm1850208380">Table 1</xref>). Beta-actin (β-actin) mRNA gene was used as internal control <xref ref-type="bibr" rid="ridm1844589948">27</xref>,<xref ref-type="bibr" rid="ridm1844558636">28</xref>. The cDNA was synthesized from total RNA obtained from stimulated and unstimulated PBMC using the enzyme               superScript III reverse transcriptase. The reaction mixture  was: 5 ml of Oligo(dT)16 (50 mM); 10 ml of  5X                       first-strand buffer (250 mM); 2.5 ml of dNTP Mix (10mM); 5 ml of 0.1M DTT; 2.5 ml 40U RNase inhibitor; 5 ml 250 U enzyme superScript III reverse transcriptase and 250 ng total RNA in a total volume per reaction  of 50 ml. The final reaction mixtures were incubated at room temperature for 10 min, followed by incubation at 42°C for 50 min and then by heat inactivation at 70°C for 15 min. Then, the cDNA was amplified by PCR, which was conducted in a final volume of 20 ml. The mixture contained 2 ml 10X buffer (200 mM Tris-HCl, pH 8.4, 500 mM KCl MgCl<sub>2</sub>); 2 ml of dNTP Mix (10mM); 1 ml of each primer (20 pmol) for the cytokines under study, 0.15 ml ampli<italic>Taq</italic> DNA                      polymerase (0.75U), 4 ml of each cDNA and DEPC water (up until 20 ml) <xref ref-type="bibr" rid="ridm1844556476">29</xref>. Polymerase chain reaction was                     conducted in a thermocycler iCicler IQ<sup>TM</sup> (Bio-Rad.                    Hercules CA, USA) according to previously established conditions (<xref ref-type="table" rid="idm1850208380">Table 1</xref>). PCR product of each cytokine RNA was analyzed in an agarose gel dyed in ethidium bromide. Subsequently, it was compared with the β-actin mRNA level and denoted as relative intensity (cytokine intensity/β-actin intensity) using the software LabWorks 4.0.</p>
        <table-wrap id="idm1850208380">
          <label>Table 1.</label>
          <caption>
            <title> Sequence of the primers, size of the amplified fragment of the different citokines evaluated and programs used in reverse transcriptase-polymerase chain reaction (RT-PCR).</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <td>Cytokine and Reference</td>
                <td>Oligonucleotide sequences</td>
                <td>Amplicon length (base pairs) </td>
                <td>Themocycler Program</td>
              </tr>
              <tr>
                <td>IL-2Cerretti., <italic>et al</italic> (1986) <xref ref-type="bibr" rid="ridm1844586636">23</xref></td>
                <td>5’ AGATACAACTCT TGTCTTGC 3’5’ AGTCATTGTTGA GTAGATGC 3’</td>
                <td>457</td>
                <td>   95º,    94º,   52º,    72º,      72ºC    4’      1’       1’      1’:30’’    7’              33 CYCLES</td>
              </tr>
              <tr>
                <td>IFN-γCerretti., <italic>et al</italic> (1986) <xref ref-type="bibr" rid="ridm1844581740">24</xref> </td>
                <td>5’ TTCAGAGCCAAA TTGTCTCC  3’5’ CTGGATCTGCAG ATCATCCA  3’</td>
                <td>184</td>
                <td>   95º,    94º,    51º,     72º,     72ºC    4’       1’      1’      1’:30’’    7’31 CYCLES</td>
              </tr>
              <tr>
                <td> IL-4Heussler., <italic>et al</italic> (1992) <xref ref-type="bibr" rid="ridm1844578860">25</xref> </td>
                <td>5’ CTATTAATGGGTCTCACCTACCA 3’3’ CTTGCCAAGCTG TTGAGATTC 5’</td>
                <td>311</td>
                <td>   94º,     94º,     51º,    72º,   72ºC     5’      30’’    45’’     1’      5’33 CYCLES</td>
              </tr>
              <tr>
                <td>IL-10Hash.,  <italic>et</italic><italic> al</italic> (1994) <xref ref-type="bibr" rid="ridm1844575620">26</xref> </td>
                <td>5’  GTTGCCTGGTCT TCCTGGCTG 3’5’ TATGTAGTTGAT GAAGATGTC 3’</td>
                <td>471</td>
                <td>   94°,  94°,  53°,  72°,  72°C    4’     1’      1’   1’:30’’  7’30 CYCLES</td>
              </tr>
              <tr>
                <td> β-actinDegen., <italic>et al </italic>(1983)<xref ref-type="bibr" rid="ridm1844589948">27</xref> </td>
                <td>5’ ACCAACTGGGAC GACATGGAG 3’5’  GCATTTGCCGTG GACAATGGA 5’</td>
                <td> 890</td>
                <td>   94º,     94º,   53º,    72º,   72ºC    5’       30’’     45’’   1’       5’28 CYCLES</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="idm1849443692">
        <title> Post Mortem Examination</title>
        <p>BTB-suspected animals were examined at post mortem in the abattoir for visible evidence of tuberculosis. The procedure involved visual inspection, palpation and incision of lungs, liver, kidneys and tracheobronchial,                  mediastinal and prescapular lymph nodes. Tissue samples were collected from cattle with suspected TB lesions              during post mortem examination. The collected tissues were sliced at 0.5 to 1 cm intervals followed by evaluation to determining the severity of gross lesions. Pathology scoring method described by Vordermeier., et<italic> al</italic>. (2002) <xref ref-type="bibr" rid="ridm1844554892">30</xref>was used to evaluate the severity of the lesions.  A score of 0, was assigned for absence of lesions; a score of 1, to a few mild lesions (1 to 2 mm in diameter); a score of 2, to a few medium lesions (1 to 5 mm in diameter) and necrotic tissue of a dimension of 5 by 5 mm; a score of 3 to multiple medium lesions presenting a size of greater than10 mm in diameter; and a score of 4 to severe multifocal lesions and large necrotic regions.</p>
      </sec>
    </sec>
    <sec id="idm1849443188">
      <title>Statistical Analysis</title>
      <p>Data were analyzed by parametric and                         non-parametric statistics using the Sigma Stat v 4.0               software (Jandel Scientific CA, USA). Statistical differences identified in the results were considered significant at             <italic>P</italic>&lt; 0.05 when compared with their respective controls. </p>
    </sec>
    <sec id="idm1849442972" sec-type="results">
      <title>Results</title>
      <sec id="idm1849442252">
        <title>Tuberculin Skin Test </title>
        <p>Thirteen from 23 tuberculosis-suspected cattle were extreme reactors to tuberculin test. These animals displayed a mean skin thickness value of  &gt;37 mm (± 9.7 mm) for bovine PPD, (<xref ref-type="table" rid="idm1850122236">Table 2</xref>). In contrast, the                       remaindaining animals in the test groups and the 10              clinically healthy animals in the control group did not show a significant reaction in skin after inoculation of <italic>M. </italic><italic>bovis</italic> PPD or <italic>M. avium</italic> PPD. Group 1, was formed by 13 cows, which were positive to both Single Intradermal Comparative Cervical Tuberculin (SICCT) test and IFN-γ assay. Group 2, included 10 cows that were negative to tuberculin test and IFN-γ assay. Group 3, was constituted by 10 clinically healthy cows used as control group, which were negative to the different immunodiagnostic tests realized. Values denote mean ± standard deviation of               optical density (OD492) obtained in serum samples from cattle. </p>
        <table-wrap id="idm1850122236">
          <label>Table 2.</label>
          <caption>
            <title> Results of a comparative ELISA that detects bovine serum antibodies to culture-filtrate protein extract from M. bovis or M. avium </title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <th colspan="4">
                  <bold> </bold>
                </th>
                <td colspan="2">
                  <bold>Comparative ELISA</bold>
                </td>
              </tr>
              <tr>
                <td>
                  <bold>Groups</bold>
                </td>
                <td>n</td>
                <td>SICCT test</td>
                <td>IFN-γ (BOVIGAM) </td>
                <td>
                  <italic>M. </italic>
                  <italic>bovis</italic>
                </td>
                <td>
                  <italic>M. </italic>
                  <italic>avium</italic>
                </td>
              </tr>
              <tr>
                <td>
                  <bold>1</bold>
                </td>
                <td>13</td>
                <td>positive</td>
                <td>positive</td>
                <td>0.489 ± 0.100</td>
                <td>0.332 ± 0.130</td>
              </tr>
              <tr>
                <td>
                  <bold>2</bold>
                </td>
                <td>10</td>
                <td>negative</td>
                <td>negative</td>
                <td>0.771 ± 0.102</td>
                <td>0.355 ± 0.123</td>
              </tr>
              <tr>
                <td>
                  <bold>3</bold>
                </td>
                <td>10</td>
                <td>negative</td>
                <td>negative</td>
                <td>0.197 ± 0.079</td>
                <td>0.166 ± 0.048</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="idm1849414532">
        <title>IFN-γ Production</title>
        <p>Plasma samples from 13 tuberculin-reactor                animals showed an IFN-<bold>γ</bold> OD<sub>450</sub> mean value upon bovine PPD-stimulation, which was 7.47-fold greater than                    non-stimulated samples (0.605 ± 0.313 vs 0.080 ± 0.033, respectively). Correspondingly, the IFN<bold>-</bold><bold>γ</bold> level in response to stimulation by avian PPD was 0.393 ± 0.290, whereas that the upon Con A-stimulation the mean value was 1.026 ± 0.297. Thus, the group was considered positive (<xref ref-type="table" rid="idm1850122236">Table 2</xref>), according to the criteria of the BOVIGAM<sup>TM</sup> test. On the contrary, 10 bTB-suspected cattle (group 2, anergic) but negative to tuberculin test exhibited low IFN<bold>-</bold><bold>γ</bold> levels after stimulation with either bovine or avian PPD (0.100 ± 0.026 and 0.124± 0.060, respectively). As a result, they were considered negative to this test (<xref ref-type="table" rid="idm1850122236">Table 2</xref>). Likewise, a low mean level production was obtained when stimulated by Con A (0.260 ± 0.173) in whole blood cultures of              anergic animals. Therefore, IFN-<bold>γ</bold> level was 3.94-fold                lower than that produced by tuberculin-positive animals.</p>
        <p>The IFN<bold>-</bold><bold>γ</bold> production in plasma samples from 10 tuberculin-negative healthy control animals was as         follows: IFN<bold>-</bold><bold>γ </bold>level in non-stimulated whole blood showed OD<sub>450</sub> mean value of 0.069± 0.017, which did not increase after stimulation by either bovine or avian PPD (0.095 ± 0.015 and 0.117 ± 0.029, respectively). However, a high level of IFN<bold>-</bold><bold>γ</bold> production was observed upon Con A stimulation, 2.923 ± 0.780; which was 2.85 fold higher than the reactor group, and 11.2 fold higher than the     anergic group. </p>
      </sec>
      <sec id="idm1849388844">
        <title>Antibodies to Mycobacterial Antigens Evaluated by ELISA </title>
        <p>Serum antibodies in response to <italic>M. </italic><italic>bovis</italic> antigen in tuberculin-positive cattle showed an OD<sub>492 </sub>mean value of 0.489 ± 0.100, which was 2.5 fold higher than the                 control (0.197 ± 0.079). While, bTB-suspected                      tuberculin-negative cattle with low IFN<bold>-</bold><bold>γ</bold> release in              response to Con A stimulation, showedmean value of 0.771 ± 0.102 (<xref ref-type="table" rid="idm1850122236">Table 2</xref>). The positive ELISA reaction             detected in tuberculin-negative cattle showed a mean          value of 1.57 fold higher than tuberculin-positive cattle (0.771 ± 0.102 vs 0.489± 0.100). With regard to ELISA reactions using <italic>M. avium</italic> antigen, the mean values of sera from tuberculin-positive cattle and bTB-suspected              tuberculin-negative cattle were similar (0.332± 0.130 and 0.355 ± 0.123, respectively). However, the above results were 2.0 to 2.13-fold higher than the OD<sub>492 </sub>mean value(0.166 ± 0.048) when compared to the control group (<xref ref-type="table" rid="idm1850122236">Table 2</xref>).       </p>
        <table-wrap id="idm1850126268">
          <label>Table 3.</label>
          <caption>
            <title> Macroscopic lung, tracheal,  lymph node lesion scores in cows of the groups 1 and 2</title>
          </caption>
          <table rules="all" frame="box">
            <tbody>
              <tr>
                <th colspan="2">
                  <bold> </bold>
                </th>
                <td colspan="4">
                  <bold>HEAD-MANDIBULAR</bold>
                </td>
                <td colspan="2">
                  <bold>NECK</bold>
                </td>
                <td colspan="3">
                  <bold>THORAX</bold>
                </td>
                <td colspan="2">
                  <bold>ABDOMEN</bold>
                </td>
                <td colspan="3">
                  <bold>CARCASS</bold>
                </td>
              </tr>
              <tr>
                <td>
                  <bold>GROUPS</bold>
                </td>
                <td>
                  <bold>Animal</bold>
                </td>
                <td>Lateral  retropharyngeal</td>
                <td>Medial retropharyngeal</td>
                <td>Submandibular</td>
                <td>Parotid</td>
                <td>Deep cervical</td>
                <td>Tracheal</td>
                <td>Lung</td>
                <td>Thoracic tracheal</td>
                <td>Mediastinal</td>
                <td>Hepatic</td>
                <td>Mesenteric</td>
                <td>Superficial Cervical</td>
                <td>Inguinal</td>
                <td>Internal iliac</td>
              </tr>
              <tr>
                <td>GROUP 1</td>
                <td>1</td>
                <td>2</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>2</td>
                <td>2</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>3</td>
                <td>0</td>
                <td>1</td>
                <td>2</td>
                <td>1</td>
                <td>2</td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>4</td>
                <td>2</td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>5</td>
                <td>0</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>6</td>
                <td>2</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td>1</td>
                <td>1</td>
                <td>1</td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>7</td>
                <td>0</td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>8</td>
                <td>1</td>
                <td>0</td>
                <td>1</td>
                <td>1</td>
                <td>2</td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>9</td>
                <td>0</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>10</td>
                <td>2</td>
                <td>1</td>
                <td> </td>
                <td>1</td>
                <td>2</td>
                <td>1</td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>11</td>
                <td>1</td>
                <td>2</td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td>1</td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>12</td>
                <td>0</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>13</td>
                <td>2</td>
                <td>0</td>
                <td>2</td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td>1</td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
              </tr>
              <tr>
                <td>GROUP 2</td>
                <td>1</td>
                <td>0</td>
                <td>3</td>
                <td> </td>
                <td> </td>
                <td>3</td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td>3</td>
                <td>2</td>
                <td>1</td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>2</td>
                <td>0</td>
                <td>4</td>
                <td> </td>
                <td>1</td>
                <td>2</td>
                <td>4</td>
                <td>1</td>
                <td> </td>
                <td>4</td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>3</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>4</td>
                <td>0</td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>5</td>
                <td>0</td>
                <td>3</td>
                <td> </td>
                <td> </td>
                <td>4</td>
                <td>2</td>
                <td>1</td>
                <td>2</td>
                <td>2</td>
                <td> </td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td>1</td>
              </tr>
              <tr>
                <td/>
                <td>6</td>
                <td>3</td>
                <td> </td>
                <td>3</td>
                <td> </td>
                <td>3</td>
                <td>2</td>
                <td>3</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td>1</td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>7</td>
                <td>0</td>
                <td>4</td>
                <td>2</td>
                <td> </td>
                <td>4</td>
                <td>2</td>
                <td>2</td>
                <td> </td>
                <td>2</td>
                <td>4</td>
                <td> </td>
                <td>2</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>8</td>
                <td>0</td>
                <td>4</td>
                <td> </td>
                <td> </td>
                <td>4</td>
                <td> </td>
                <td>3</td>
                <td>3</td>
                <td>2</td>
                <td>3</td>
                <td>3</td>
                <td>3</td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>9</td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
                <td> </td>
              </tr>
              <tr>
                <td/>
                <td>10</td>
                <td>3</td>
                <td> </td>
                <td> </td>
                <td>3</td>
                <td>4</td>
                <td>  3</td>
                <td> </td>
                <td>3</td>
                <td>2</td>
                <td>1</td>
                <td>1</td>
                <td>1</td>
                <td>1</td>
                <td> </td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn id="idm1849181564">
              <label/>
              <p><bold>0 </bold>In the absence of lesions<bold/></p>
            </fn>
            <fn id="idm1849181132">
              <label/>
              <p><bold>1</bold>  Few slight lesions        </p>
            </fn>
            <fn id="idm1849182068">
              <label/>
              <p><bold>2</bold>   Several median lesions<bold/></p>
            </fn>
            <fn id="idm1849181924">
              <label/>
              <p><bold>3 </bold>  Multiple median lesions        </p>
            </fn>
            <fn id="idm1849180340">
              <label/>
              <p><bold>4  </bold>Multifocal severe lesions</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
      <sec id="idm1849179764">
        <title>Study Groups for Cytokines </title>
        <p>PBMC from cattle of each group were individually stimulated with bovine-PPD, avian-PPD, and Con A                    mitogen for 72h. Cytokine transcript responses were               analyzed by semi-quantitative RT-PCR. The mRNA levels were calculated as the ratio between the band intensity of each cytokine and the corresponding β-actin (<xref ref-type="fig" rid="idm1849751204">Figure 1</xref>). In group 1, the production of IFN<bold>-</bold><bold>γ</bold> and IL-2 (108.2 ± 19 and 91.8 ± 9.8, respectively) in PBMC stimulated by                     bovine-PPD, was similar to Con A-stimulated cells, with the exception of IL-4 (70.2 ± 9.8). The mRNA levels upon stimulation by Con A were IFN<bold>-</bold><bold>γ</bold> (118 ± 13), IL-2 (78.7 ± 9.5), and IL-4 (74.8 ± 9.8). In contrast, low transcript              levels to IFN<bold>-</bold><bold>γ</bold> (43.9 ± 6.6), IL-2 (19.3 ± 4.6), and IL-4 (5.9 ± 1.3) were detected in response to avian PPD. The                 expression of IL-10 was not detected in PBMC stimulated by bovine PPD, avian PPD nor Con-A (<xref ref-type="fig" rid="idm1849750700">Figure 2</xref>A). On the contrary, in group 2, IL-10 had a significantly high                 production (85.7 ± 7.1) only upon stimulation by bovine PPD (<xref ref-type="fig" rid="idm1849750700">Figure 2</xref>B). IL-10 was not detected in groups 1 and 3. Though there were transcripts to IL-10 upon PPD                <italic>avium</italic>- or Con A-stimulation (31.4 ± 5.7 and 42.8 ± 4.6, respectively), the levels were similar to samples from         non-stimulated cells (23.3 ± 3.8) (<xref ref-type="fig" rid="idm1849750700">Figure 2</xref> B). Bovine PPD also stimulated production of IL-4 (54 ± 7.7), which was 1.3 fold lower than group 1. The level of IL-4 transcript upon stimulation by PPD <italic>avium</italic> exhibited 3.7 fold more relative intensity (21.7 ± 2.9) than the bovines from group 1 (5.9 ± 1.3) (<xref ref-type="fig" rid="idm1849750700">Figure 2</xref>. A and B). Similar production of IL-4 was also observed upon Con A-stimulation (20 ± 3.9). However, although cells produced IFN<bold>-</bold><bold>γ</bold> and IL-2 upon stimulation by bovine PPD, avian PPD, or Con A, results were below the background level of the control group (<xref ref-type="fig" rid="idm1849750700">Figure 2</xref>B)<bold>. </bold></p>
        <fig id="idm1849751204">
          <label>Figure 1.</label>
          <caption>
            <title> Cytokine mRNA levels of bovine PPD stimulated Peripheral Blood Mononuclear Cells measured by semi-quantitative RT-PCR. A representative picture is shown. The expression levels of mRNA were calculated as the ratio between the band intensity of cytokine mRNA an that of                       corresponding β-actin mRNA in the linear range.</title>
          </caption>
          <graphic xlink:href="images/image1.jpg" mime-subtype="jpg"/>
        </fig>
        <fig id="idm1849750700">
          <label>Figure 2.</label>
          <caption>
            <title> Semiquantitative RT-PCR analysis of cytokine mRNA expression in PBMC from naturally tuberculosis infected cattle after stimulation with bovine PPD (hatched bars), avian PPD (black dotted bars), Con-A (grey bars), or médium alone (White dotted bars) at 72 h of cell culture. (A) Group 1 (n=13), cows positive to all diagnosis tests (SICCT test, BOVIGAM and a serological comparative ELISA). (B) Group 2 (n=10), cows were only positive to comparative ELISA. (C) Control Group (n=10), cows negative to all disgnosis tests. Results are expressed as mean ± SD from relative intensity of the m RNAs (cytokine band/ β-actin band) measured by LabWorks 4.0 software. </title>
          </caption>
          <graphic xlink:href="images/image2.jpg" mime-subtype="jpg"/>
        </fig>
        <p>As expected, PBMC from healthy control group produced very low IFN<bold>-</bold><bold>γ</bold> levels that were only detected after stimulation by bovine PPD (12 ± 3). In this group,                 IL-2, IL-4 and IL-10 transcripts were not observed upon stimulation, with neither bovine PPD nor avian PPD (<xref ref-type="fig" rid="idm1849750700">Figure 2</xref> C). Similarly, as expected, the control group produced IFN<bold>-</bold><bold>γ</bold> (110 ± 13.6) and IL-2 (70.1 ± 10.7), but not IL-4 or IL-10 transcripts in response to stimulation by Con A.</p>
      </sec>
      <sec id="idm1849172708">
        <title>Post-Mortem Examinations</title>
        <p>Lymphatic tissue lesions were measured in                 parotid, submandibular, lateral and medial                              retropharyngeal, deep and superficial cervical, pulmonary, thoracic-tracheal, mediastinal, hepatic, inguinal, iliac, and mesenteric lymph nodes. In group 1, nine cows displayed mainly median lesions in deep cervical and lateral                   retropharyngeal lymph nodes. Twenty-three to 38%               animals exhibited small lesions in examined lymph nodes, while 3 animals did not show any bTB-visible lesion in all the examined tissue. In group 2, 50-60% cows showed severe lesions in medial retropharyngeal, deep and                superficial cervical lymph nodes, which were scored 3 and 4. Moreover, these animals showed severe pulmonary               lesions that were considered as score 3. However, 2 cows did not show bTB-associated lesions in lymphatic tissues nor in lung lobes sliced into thin sections (<xref ref-type="table" rid="idm1850126268">Table 3</xref>).</p>
      </sec>
    </sec>
    <sec id="idm1849173572" sec-type="discussion">
      <title>Discussion</title>
      <p>Ante mortem diagnosis to detect infected animals is critical for successful eradication and control of bovine tuberculosis. Tuberculin skin and interferon-gamma tests are both based on the detection of early cell-mediated           immune response in tuberculosis infection are employed for eradication and control. However, at late disease stage, false negative results are observed due to waning                  cell-mediated immune response as opposed to a generally increasing humoral immune response. <xref ref-type="bibr" rid="ridm1844605828">16</xref><xref ref-type="bibr" rid="ridm1844568644">31</xref><xref ref-type="bibr" rid="ridm1844563532">32</xref>. After                            diagnosis, rapid removal of infected cattle is performed in order to reduce the risk of tuberculosis spread. On the other hand, in the presence of a virulent<italic> M. </italic><italic>bovis</italic> strain, there are two types of animals, resistant and susceptible cattle to bovine tuberculosis. In susceptible animals, the infection is progressive possibly leading to anergy, while other <italic>M. </italic><italic>bovis</italic>-infected animals are resistant to bTB. In this study, analyzed animals came from a herd where a                  comparative tuberculin skin test was applied for detection of cattle infected by <italic>M. </italic><italic>bovis</italic>. At the time of the study,             bovine tuberculosis prevalence determined by us was 25% using comparative tuberculin skin test. Therefore, blood sample was collected from all cows from the target herd for initial screening serologically by comparative ELISA, followed by subsequent studies on mostly animals with high levels of antibodies by BOVIGAM. Twenty-three bTB-suspected cattle were selected according to the            results of the diagnostic tests used, 13 of them were                 positive to all the three tests (SICCT test, BOVIGAM and ELISA), while the remaining 10 were positive only to the serological test. The latter are considered probably               anergic animals. Due to their negative test result to                 intradermal tuberculin test and the high levels of                     antibodies they had. In this sense, various authors have recommended alternative diagnostic tools based on the detection of serum <italic>M. </italic><italic>bovis</italic>-specific antibodies <xref ref-type="bibr" rid="ridm1844623348">14</xref>,<xref ref-type="bibr" rid="ridm1844537628">33</xref>. For this, mycobacterial antigens such as ESAT-6 and CFP-10 have been proposed to antigenic targets to improve the detection of <italic>M. </italic><italic>bovis</italic>-infected animals <xref ref-type="bibr" rid="ridm1844532156">34</xref>. In addition, a large number of mycobacterial novel antigens recognized by serum antibodies from bTB-animals have showed                  being useful molecular candidates to the future                     development of a more sensitive serological assay <xref ref-type="bibr" rid="ridm1844531652">35</xref>. Our result showed that ELISA is an important serologic test to detect humoral response <xref ref-type="bibr" rid="ridm1844525316">36</xref>. So that, serological test should be considered as an ancillary test to be used in parallel with tuberculin skin test and IFN<bold>-</bold><bold>γ</bold> assay. Gamma                 interferon release assay (BOVIGAM) has the ability to identify naturally infected animals at an early stage, when they have a negative intradermal tuberculin test result. Furthermore, BOVIGAM assay have greater sensitivity and specificity than intradermal tuberculin test showing    greater correlation with pathology; however, it fails to detect anergic animals, a problem it shares with the                  tuberculin test <xref ref-type="bibr" rid="ridm1844595748">20</xref>,<xref ref-type="bibr" rid="ridm1844521500">37</xref>.</p>
      <p>On the other hand, other investigations on                   biomarkers such as cytokines from immune response have been conducted. The measurement of pro-inflammatory and anti-inflammatory cytokines could support to                understand bovine immune response to develop                     diagnostic tools and design vaccines. In this way, PBMC from experimentally <italic>M. </italic><italic>bovis</italic>-infected animals have been incubated by PPD <italic>bovis</italic> and after culture, cytokine mRNA production analyzed. In a study, transcripts to IFN<bold>-</bold><bold>γ</bold>,                 TNF-α, iNOS and IL-4 were higher in bTB-cattle with high pathology than in those with low pathology <xref ref-type="bibr" rid="ridm1844658564">5</xref>. With regard to IL-10 cytokine, bTB-cattle with high pathology showed 2-fold less IL-10 mRNA than did animals with low                      pathology <xref ref-type="bibr" rid="ridm1844658564">5</xref>,<xref ref-type="bibr" rid="ridm1844519412">38</xref>. This outcome has suggested that a strong immunological response is associated with increased                 pathology. A similar study showed that transcripts to IL-2, IL-17, and sometimes IL-10 could be potential predictors of disease progression in cattle exposed to <italic>M. </italic><italic>bovis</italic><xref ref-type="bibr" rid="ridm1844515740">39</xref>. We also performed a PBMC culture to identify                                   pro-inflammatory and anti-inflammatory cytokine                    transcripts by RT-PCR. We found that positive animals to all tests exhibited transcripts to IFN-γ, IL-2 and IL-4 by PBMC upon PPD <italic>bovis</italic>-specific or Con A-mitogen                         stimulation. Our results coincide with those from Thacker, <italic>et al</italic> (2007) <xref ref-type="bibr" rid="ridm1844658564">5</xref> who found high IFN-γ and IL-4 levels in                  bTB-cattle with high pathology as cited. The presence of IL-4 in these animals is consistent with high serum anti-PPD <italic>bovis</italic> antibody titers, because IL-4 is an important factor to humoral immune response. IL-4 is also an                                anti-inflammatory cytokine that regulates the                             cell-mediated immune response.           </p>
      <p>In contrast, we found that bTB-suspected animals were negative to both tuberculin test and IFN<bold>-</bold><bold>γ</bold> assay, and showed a high transcript levels for IL-10 upon stimulation by PPD <italic>bovis</italic>. This is consistent with the negative result to IFN<bold>-</bold><bold>γ</bold> assay in these animals since IL-10 inhibits                          production of IFN<bold>-</bold><bold>γ</bold> from PPD-stimulated whole blood cells. Some of the biological effects that are induced by                      IL-10 are deactivation of macrophages and decreased          production of reactive nitrogen and oxygen species;                   consequently, in its absence, a stronger Th1 immune               response is incited, while elevated levels of IL-10 are                associated with increased susceptibility to mycobacterial                infection, rendering the Th2-associated cytokine IL-10 a critical anti-inflammatory. Hence, the Th2-associated                 cytokine IL-10 is considered a critical anti-inflammatory mediator of innate and adaptive responses to pathogenic mycobacteria. It appears that  mostly an inverse                       relationship exists between IL-10 and IFN-γ<xref ref-type="bibr" rid="ridm1844544396">40</xref>.  In this     regard, Welsh., <italic>et al. </italic>(2005) <xref ref-type="bibr" rid="ridm1844541444">41</xref> analyzed PBMC cytokine mRNA of experimentally infected cattle, and reported high IL-10 levels prior to infection, which gradually declined following infection as higher IFN-expression was detected. However, the authors registered a significant increase in the expression of IL-10 in cattle that showed the greatest severity of disease. In addition, levels higher in expression IL-10 correlated with decreasing CMI and increasing                humoral responses.</p>
      <p>Sheridan., <italic>et al</italic> (2017) <xref ref-type="bibr" rid="ridm1844502620">42</xref> have demonstrated that IFN<bold>-</bold><bold>γ</bold> levels increased when IL-10 was neutralized by       addition of an anti-IL-10 antibody in bovine                       PPD-stimulated whole blood culture <xref ref-type="bibr" rid="ridm1844525316">36</xref>. We think animals from group 2 were found in an anergy status because            cytokines decreased when PBMC were stimulated by Con A-mitogen. Moreover, positive animals to all tests showed small and medium lesions in lymph nodes  during                   post-mortem examination. This result suggested that the animals were fighting the pathogen, or were tested at            onset or during primary <italic>M. </italic><italic>bovis</italic>-infection. Consistently, three animals from group 1 didn’t show lesions in tissues analyzed in the study. We concluded cows were infected with <italic>M. </italic><italic>bovis</italic>, since stimulation of PBMC by <italic>M. avium</italic> showed a limited production of cytokine transcripts. On the contrary, animals from group 2 displayed the highest anti-<italic>M. </italic><italic>bovis</italic> antibody levels in blood serum and a high              IL-10 production only in<italic> M. </italic><italic>bovis</italic>-stimulated cells.               Likewise, these animals exhibit multifocal severe lesions in lymphatic tissues. Thus, the results suggested that               animals from group 2 were experiencing progressive             tuberculosis; possibly, they may be in an advanced stage. Hence, negative animals to both tuberculin skin test and IFN<bold>-</bold><bold>γ</bold> assay, with suggestive signs of bTB should be                    subjected to ELISA test together with a bovine PPD                stimulated-PBMC IL-10 cytokine expression. Therefore, the elucidation and understanding on the dynamics of Th1/Th2 cytokine profile changes at different stages of infection contributes to the identification and                           development of diagnostic biomarkers more efficient. In view of the above, if animals are not detected by                   tuberculin test or IFN-<bold>γ</bold>, we suggest the use of a serologic test to detect anti-<italic>M. </italic><italic>bovis</italic> antigen antibodies together with IL-10 cytokine expression after cultured PBMC whole cells are stimulated by bovine PPD. Because, anergic           animals constitute an important source of infection within herds, especially in those that are under disease control phase. The establishment of diagnostic methodologies based on the detection of specific antibodies against <italic>M. </italic><italic>bovis</italic> antigens, together with tests that evaluate cellular immunity, will help improve disease control programs and reduce the risk of infection to humans and cattle,                      considering the different patterns of immune response that are observed as the disease progresses, as observed in the study conducted. Thus, the use of parallel testing that evaluate both types of immune response would allow herds sanitation to be achieved in less time, since the                recurrence of reactors in herds declared free of                      tuberculosis can be prevented through planned follow-up. </p>
    </sec>
    <sec id="idm1849154276" sec-type="conclusions">
      <title>Conclusion </title>
      <p>The expression analysis of the main cytokines of the Th1/Th2 immunological profile carried out indicates differences among the evaluated groups, showing that high anti <italic>M. </italic><italic>bovis</italic> antibody titers in blood serum and high IL-10 production in PBMC are indicators of progressive bTB when both tuberculin test and IFN<bold>-</bold><bold>γ</bold> assay are                    negative in tuberculous anergic cattle. Consequently, the evaluation of these parameters or biomarkers in tandem with tests that evaluate cellular immunity will help to                  improve disease control programs.</p>
    </sec>
  </body>
  <back>
    <ack>
      <p>Funding for this study came from the Instituto Nacional de Investigaciones Forestales, Agrícolas y                   Pecuarias (INIFAP) México, with a registry number in the Integral System of Institutional Management of 14294534013.</p>
    </ack>
    <ref-list>
      <ref id="ridm1844802980">
        <label>1.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Good</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Bakker</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Duignan</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Collins</surname>
            <given-names>D M</given-names>
          </name>
          <article-title>The history of in vivo tuberculin testing in bovines: Tuberculosis, a &amp;quot;one health&amp;quot; issue. Front Vet Sci</article-title>
          <date>
            <year>2018</year>
          </date>
          <volume>5</volume>
          <fpage>59</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844804996">
        <label>2.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Sorensen</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Beest</surname>
            <given-names>F M van</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>K Brook</given-names>
          </name>
          <article-title>Impacts of wildlife baiting and supplemental feeding on infectious disease transmission risk: a synthesis of knowledge. Prev Vet Med</article-title>
          <date>
            <year>2014</year>
          </date>
          <volume>113</volume>
          <fpage>356</fpage>
          <lpage>63</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844812420">
        <label>3.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Welsh</surname>
            <given-names>M D</given-names>
          </name>
          <name>
            <surname>Cunningham</surname>
            <given-names>R T</given-names>
          </name>
          <name>
            <surname>Corbett</surname>
            <given-names>D M</given-names>
          </name>
          <name>
            <surname>Girvin</surname>
            <given-names>R M</given-names>
          </name>
          <name>
            <surname>McNair</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Skuce</surname>
            <given-names>R A</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>G Bryson</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>M Pollock</given-names>
          </name>
          <article-title>Influence of pathological progression on the balance between cellular and humoral immune responses in bovine tuberculosis</article-title>
          <date>
            <year>2005</year>
          </date>
          <source>Immunology</source>
          <volume>114</volume>
          <fpage>101</fpage>
          <lpage>111</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844907956">
        <label>4.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Walravens</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Wellemans</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Weynants</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Boelaert</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>V</surname>
            <given-names>de Bergeyck</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names/>
          </name>
          <name>
            <surname>Huygen</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Godfroid</surname>
            <given-names>J</given-names>
          </name>
          <article-title>Analysis of the antigen-specific IFN-gamma producing T-cell subsets in cattle experimentally infected with Mycobacterium bovis</article-title>
          <date>
            <year>2002</year>
          </date>
          <source>Vet Immunol Immunopathol</source>
          <volume>84</volume>
          <fpage>29</fpage>
          <lpage>41</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844658564">
        <label>5.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Thacker</surname>
            <given-names>T C</given-names>
          </name>
          <name>
            <surname>Palmer</surname>
            <given-names>M V</given-names>
          </name>
          <name>
            <surname>Waters</surname>
            <given-names>W R</given-names>
          </name>
          <article-title>Associations between cytokine gene expression and pathology in Mycobacterium bovis infected cattle. Vet Immunol Immunopathol</article-title>
          <date>
            <year>2007</year>
          </date>
          <volume>119</volume>
          <fpage>204</fpage>
          <lpage>213</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844663172">
        <label>6.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>J</surname>
            <given-names>S Rothel</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>L Jones</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>A Corner</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>C Cox</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>R Wood</given-names>
          </name>
          <article-title>The gamma-interferon assay for diagnosis of bovine tuberculosis in cattle: conditions affecting the production of gamma-interferon in whole blood culture</article-title>
          <date>
            <year>1992</year>
          </date>
          <source>Aust Vet J</source>
          <volume>69</volume>
          <fpage>1</fpage>
          <lpage>4</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844651676">
        <label>7.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Schiller</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Waters</surname>
            <given-names>W R</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>M Vordermeier</given-names>
          </name>
          <name>
            <surname>Nonnecke</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Welsh</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Keck</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Whelan</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Sigafoose</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Stamm</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Palmer</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Thacker</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Hardegger</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Marg-Haufe</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>Raeber</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Oesch</surname>
            <given-names>B</given-names>
          </name>
          <article-title>Optimization of a whole-blood gamma interferon assay for detection of Mycobacterium bovis-infected cattle</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>Clin Vaccine Immunol</source>
          <volume>16</volume>
          <fpage>1196</fpage>
          <lpage>202</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844654916">
        <label>8.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Vordermeier</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>V Gordon</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>G Hewinson</given-names>
          </name>
          <article-title>Mycobacterium bovis antigens for the differential diagnosis of vaccinated and infected cattle</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>Vet Microbiol</source>
          <volume>151</volume>
          <fpage>8</fpage>
          <lpage>13</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844640732">
        <label>9.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Maggioli</surname>
            <given-names>M F</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>V Palmer</given-names>
          </name>
          <name>
            <surname>Thacker</surname>
            <given-names>T C</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>M Vordermeier</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>L McGill</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>O Whelan</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>H Larsen</given-names>
          </name>
          <name>
            <surname>Jacobs</surname>
            <given-names>W R Jr</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Increased TNF-α/ IFN-γ/IL-2 and decreased TNF-α/IFN-γ production by central memory T cells are associated with protective responses against bovine tuberculosis following BCG vaccination</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>Front Immunol</source>
          <volume>7</volume>
          <fpage>421</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844641524">
        <label>10.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Maggioli</surname>
            <given-names>M F</given-names>
          </name>
          <name>
            <surname>Palmer</surname>
            <given-names>M V</given-names>
          </name>
          <name>
            <surname>Thacker</surname>
            <given-names>T C</given-names>
          </name>
          <name>
            <surname>Vordermeier</surname>
            <given-names>H M</given-names>
          </name>
          <name>
            <surname>Waters</surname>
            <given-names>W R</given-names>
          </name>
          <article-title>Characterization of effector and memory T cell subsets in the immune response to bovine tuberculosis in cattle. PLoS One</article-title>
          <date>
            <year>2015</year>
          </date>
          <volume>10</volume>
          <issue>4</issue>
          <fpage>0122571</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844632708">
        <label>11.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>A</surname>
            <given-names>O Whelan</given-names>
          </name>
          <name>
            <surname>Villarreal-Ramos</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>M Vordermeier</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>J Hogarth</given-names>
          </name>
          <article-title>Development of an antibody to bovine IL-2 reveals multifunctional CD4 T (EM) cells in cattle naturally infected with bovine tuberculosis. PLoS One</article-title>
          <date>
            <year>2011</year>
          </date>
          <volume>6</volume>
          <issue>12</issue>
          <fpage>29194</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844627020">
        <label>12.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Widdison</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>J Schreuder</given-names>
          </name>
          <name>
            <surname>Villarreal-Ramos</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>J Howard</given-names>
          </name>
          <name>
            <surname>Watson</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>J Coffey</given-names>
          </name>
          <article-title>Cytokine expression profiles of bovine lymph nodes: effects of Mycobacterium bovis infection and Bacille Calmette-Guérin vaccination. Clin Exp Immunol.144</article-title>
          <date>
            <year>2006</year>
          </date>
          <fpage>281</fpage>
          <lpage>289</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844625292">
        <label>13.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Shu</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Heiser</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>N Wedlock</given-names>
          </name>
          <name>
            <surname>Luo</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Lisle</surname>
            <given-names>G W de</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Comparison of gene expression of immune mediators in lung and pulmonary lymph node granulomas from cattle experimentally with Mycobacterium bovis. Vet Immunol Immunopathol</article-title>
          <date>
            <year>2014</year>
          </date>
          <volume>160</volume>
          <fpage>81</fpage>
          <lpage>89</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844623348">
        <label>14.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Casal</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Infantes</surname>
            <given-names>J A</given-names>
          </name>
          <name>
            <surname>Risalde</surname>
            <given-names>M A</given-names>
          </name>
          <name>
            <surname>Díez-Guerrier</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Domínguez</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Moreno</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Romero</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>de Juan</given-names>
          </name>
          <name>
            <surname>Sáez</surname>
            <given-names>J L</given-names>
          </name>
          <name>
            <surname>Juste</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Gortázar</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Domínguez</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Bezos</surname>
            <given-names>J</given-names>
          </name>
          <article-title>Antibody detection tests improve the sensitivity of tuberculosis diagnosis in cattle. Res Vet Sci</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>112</volume>
          <fpage>214</fpage>
          <lpage>221</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844617660">
        <label>15.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <article-title>Norma Oficial Mexicana NOM-031-ZOO. Campaña Nacional Contra la Tuberculosis Bovina (Mycobacterium bovis). Secretaria de Agricultura, Ganadería y Desarrollo Rural</article-title>
          <date>
            <year>1995</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1844605828">
        <label>16.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Wood</surname>
            <given-names>P R</given-names>
          </name>
          <name>
            <surname>Jones</surname>
            <given-names>S L</given-names>
          </name>
          <article-title>BOVIGAM: an in vitro cellular diagnostic test for bovine tuberculosis. Tuberculosis (Edinb)81(1-2):</article-title>
          <date>
            <year>2001</year>
          </date>
          <fpage>147</fpage>
          <lpage>55</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844604028">
        <label>17.</label>
        <mixed-citation xlink:type="simple" publication-type="book"><name><surname>C</surname><given-names>O Thoen</given-names></name><article-title>The genus Mycobacterium. In:</article-title><date><year>1990</year></date><chapter-title>Diagnostic Procedures in Veterinary Bacteriology and Mycology. 5th edition</chapter-title><fpage>287</fpage><lpage>298</lpage>
Carter GR, Cole Jr JR, editors
<publisher-name>Academic Press Inc</publisher-name><publisher-loc>San Diego, CA</publisher-loc></mixed-citation>
      </ref>
      <ref id="ridm1844602372">
        <label>18.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Nagai</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Matsumoto</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Nagasuga</surname>
            <given-names>T</given-names>
          </name>
          <article-title>Specific skin-reactive protein from culture filtrate of Mycobacterium bovis BCG</article-title>
          <date>
            <year>1981</year>
          </date>
          <source>Infect Immun</source>
          <volume>31</volume>
          <fpage>1152</fpage>
          <lpage>1160</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844599780">
        <label>19.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bradford</surname>
            <given-names>M M</given-names>
          </name>
          <article-title>A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding</article-title>
          <date>
            <year>1976</year>
          </date>
          <source>Anal Biochem</source>
          <volume>72</volume>
          <fpage>248</fpage>
          <lpage>254</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844595748">
        <label>20.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Díaz-Otero</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Banda-Ruíz</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Jaramillo-Meza</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Arriaga-Díaz</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>González-Salazar</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Estrada-Chávez</surname>
            <given-names>C</given-names>
          </name>
          <article-title>Identification of Mycobacterium bovis infected cattle by immunological and molecular methods</article-title>
          <date>
            <year>2003</year>
          </date>
          <source>Vet. Méx</source>
          <volume>34</volume>
          <fpage>13</fpage>
          <lpage>26</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844607700">
        <label>21.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Boyum</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Isolation of lymphocytes, granulocytes and macrophages</article-title>
          <date>
            <year>1976</year>
          </date>
          <source>Scand J Immunol</source>
          <volume>5</volume>
          <fpage>9</fpage>
          <lpage>15</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844587932">
        <label>22.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Chomczynski</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Sacchi</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction</article-title>
          <date>
            <year>1987</year>
          </date>
          <source>Anal Biochem</source>
          <volume>162</volume>
          <fpage>156</fpage>
          <lpage>159</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844586636">
        <label>23.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>D</surname>
            <given-names>P Cerreti</given-names>
          </name>
          <name>
            <surname>McKereghan</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Larsen</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Cantrell</given-names>
          </name>
          <name>
            <surname>Anderson</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Cosman</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Gillis</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>E Baker</given-names>
          </name>
          <article-title>Cloning, sequence, and expression of bovine interleukin 2</article-title>
          <date>
            <year>1986</year>
          </date>
          <chapter-title>Proc Natl Acad Sci USA</chapter-title>
          <volume>83</volume>
          <fpage>3223</fpage>
          <lpage>3227</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844581740">
        <label>24.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>D</surname>
            <given-names>P Cerreti</given-names>
          </name>
          <name>
            <surname>McKereghan</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Larsen</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Cosman</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Gillis</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>E Baker</given-names>
          </name>
          <article-title>Cloning, sequence, and expression of bovine interferon-gamma</article-title>
          <date>
            <year>1986</year>
          </date>
          <source>J Immunol</source>
          <volume>136</volume>
          <fpage>4561</fpage>
          <lpage>4564</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844578860">
        <label>25.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Heussler</surname>
            <given-names>V T</given-names>
          </name>
          <name>
            <surname>Eichhorn</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Dobbelaere</surname>
            <given-names>D A</given-names>
          </name>
          <article-title>Cloning of a full-length cDNA encoding bovine interleukin 4 by the polymerase chain reaction</article-title>
          <date>
            <year>1992</year>
          </date>
          <source>Gene</source>
          <volume>114</volume>
          <fpage>273</fpage>
          <lpage>278</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844575620">
        <label>26.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>S</surname>
            <given-names>M Hash</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>C Brown</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>C Rice-Ficht</given-names>
          </name>
          <article-title>Characterization of a cDNA encoding bovine interleukin 10: kinetics of expression in bovine lymphocytes</article-title>
          <date>
            <year>1994</year>
          </date>
          <source>Gene</source>
          <volume>139</volume>
          <fpage>257</fpage>
          <lpage>61</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844589948">
        <label>27.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>J</surname>
            <given-names>L Degen</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>G Newbauer</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>J Degen</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>E Seyfreid</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>R Morris</given-names>
          </name>
          <article-title>Regulation of protein synthesis in mitogen-activated bovine lymphocytes. Analysis of actin-specific and total mRNA accumulation and utilization</article-title>
          <date>
            <year>1983</year>
          </date>
          <source>J Biol Chem</source>
          <volume>258</volume>
          <fpage>12153</fpage>
          <lpage>12162</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844558636">
        <label>28.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Covert</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Splitter</surname>
            <given-names>G</given-names>
          </name>
          <article-title>Detection of cytokine transcriptional profiles from bovine peripheral blood mononuclear cells and CD4+ lymphocytes by reverse transcriptase polymerase chain reaction</article-title>
          <date>
            <year>1995</year>
          </date>
          <source>Vet Immunol Immunopathol</source>
          <volume>49</volume>
          <fpage>39</fpage>
          <lpage>50</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844556476">
        <label>29.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Beltan</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Horgen</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Rastogi</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Secretion of cytokines by human macrophages upon infection by pathogenic and non-pathogenic Mycobacterium. Microbial Pathogenesis</article-title>
          <date>
            <year>2000</year>
          </date>
          <volume>28</volume>
          <fpage>313</fpage>
          <lpage>318</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844554892">
        <label>30.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>H</surname>
            <given-names>M Vordermeier</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Chambers</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>J Cockle</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>O Whelan</given-names>
          </name>
          <name>
            <surname>Simmons</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>G Hewinson</given-names>
          </name>
          <article-title>Correlation of ESAT-6-specific gamma interferon production with pathology in cattle following Mycobacterium bovis BCG vaccination against experimental bovine tuberculosis</article-title>
          <date>
            <year>2002</year>
          </date>
          <source>Infect. Immun</source>
          <volume>70</volume>
          <fpage>3026</fpage>
          <lpage>3032</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844568644">
        <label>31.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>T</surname>
            <given-names>A Clegg</given-names>
          </name>
          <name>
            <surname>Good</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Doyle</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Duignan</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>J More</given-names>
          </name>
          <name>
            <surname>Gormley</surname>
            <given-names>E</given-names>
          </name>
          <article-title>The performance of the interferon gamma assay when used as a diagnostic or quality assurance test in Mycobacterium bovis infected herds. Prev Vet Med</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>140</volume>
          <fpage>116</fpage>
          <lpage>121</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844563532">
        <label>32.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>De</surname>
            <given-names>La Rua-Domenech</given-names>
          </name>
          <name>
            <surname>Goodchild</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>T Vordermeier</given-names>
          </name>
          <name>
            <surname>Hewinson</surname>
            <given-names>H M</given-names>
          </name>
          <name>
            <surname>Christiansen</surname>
            <given-names>R G</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>H Clifton-Hadley</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Ante mortem diagnosis of tuberculosis in cattle: a review of the tuberculin tests, gamma-interferon assay and other ancillary diagnostic techniques. Res Vet Sci</article-title>
          <date>
            <year>2006</year>
          </date>
          <fpage>81</fpage>
          <lpage>190</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844537628">
        <label>33.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Casal</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Díez-Guerrier</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Álvarez</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Rodríguez-Campos</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Mateos</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Linscott</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Martel</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>C Lawrence</given-names>
          </name>
          <name>
            <surname>Whelan</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Clarke</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>O´Brien</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Domínguez</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Aranaz</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Strategic use of serology for the diagnosis of bovine tuberculosis after intradermal skin testing</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>Vet Microbiol</source>
          <volume>170</volume>
          <fpage>342</fpage>
          <lpage>351</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844532156">
        <label>34.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>H</surname>
            <given-names>M Vordermeier</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>V Gordon</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>G Hewinson</given-names>
          </name>
          <article-title>Mycobacterium bovis antigens for the differential diagnosis of vaccinated and infected cattle</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>Vet Microbiol</source>
          <volume>151</volume>
          <fpage>8</fpage>
          <lpage>13</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844531652">
        <label>35.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>K</surname>
            <given-names>P Lyashchenko</given-names>
          </name>
          <name>
            <surname>Grandison</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Keskinen</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Sikar-Gang</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Lambotte</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Esfandiari</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>G</surname>
            <given-names>C Ireton</given-names>
          </name>
          <name>
            <surname>Vallur</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>G Reed</given-names>
          </name>
          <name>
            <surname>Jones</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Vordermeier</surname>
            <given-names/>
          </name>
          <article-title>Identification of novel antigens recognized by serum antibodies in bovine tuberculosis. Clin Vaccine Immunol</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>24</volume>
          <issue>12</issue>
          <fpage>00259</fpage>
          <lpage>17</lpage>
          <publisher-loc>H.M., Stabel, J.R., Thacker, T.C., Palmer, M.V., Waters, WR</publisher-loc>
          <pub-id pub-id-type="pii">e00259-17</pub-id>
        </mixed-citation>
      </ref>
      <ref id="ridm1844525316">
        <label>36.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Quevillon</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Díaz-Otero</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Jaramillo-Meza</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Lascurain-Ledesma</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>A Gutiérrez-Pabello</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>A Castañeda</given-names>
          </name>
          <name>
            <surname>Arriaga-Díaz</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Pérez-González</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>X</surname>
            <given-names>E González-González</given-names>
          </name>
          <article-title>Comparison of immune peripheral blood cells in tuberculin reactor cattle that are seropositive or seronegative for Mycobacterium bovis antigens</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Vet Immunol Immunopathol</source>
          <volume>153</volume>
          <fpage>194</fpage>
          <lpage>201</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844521500">
        <label>37.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>S</surname>
            <given-names>D Neill</given-names>
          </name>
          <name>
            <surname>Cassidy</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Hanna</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>P Mackie</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>M Pollock</given-names>
          </name>
          <name>
            <surname>Clements</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Walton</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>D</surname>
            <given-names>G Bryson</given-names>
          </name>
          <article-title>Detection of Mycobacterium bovis infection in skin test-negative cattle with an assay for bovine interferon-gamma. Vet Rec</article-title>
          <date>
            <year>1994</year>
          </date>
          <volume>135</volume>
          <fpage>134</fpage>
          <lpage>135</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844519412">
        <label>38.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Cruz-Fierro</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Jaramillo-Meza</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>I Espitia-Pinzón</given-names>
          </name>
          <name>
            <surname>Pérez-González</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Manzo-Sandoval</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Díaz-Otero</surname>
            <given-names>F</given-names>
          </name>
          <article-title>Evaluación experimental de vacuna BCG y extracto proteico en bovinos, vía expresión de citocinas. Spei Domus</article-title>
          <date>
            <year>2020</year>
          </date>
          <volume>16</volume>
          <fpage>1</fpage>
          <lpage>27</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844515740">
        <label>39.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Smith</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Kleynhans</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>M Warren</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>J Goosen</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Cell-mediated immunological biomarkers and their diagnostic application in livestock and wildlife infected with Mycobacterium bovis</article-title>
          <date>
            <year>2021</year>
          </date>
          <source>Front Immunol</source>
          <volume>4</volume>
          <issue>12</issue>
          <fpage>639605</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844544396">
        <label>40.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Welsh</surname>
            <given-names>M D</given-names>
          </name>
          <name>
            <surname>Cunningham</surname>
            <given-names>R T</given-names>
          </name>
          <name>
            <surname>Corbett</surname>
            <given-names>D M</given-names>
          </name>
          <name>
            <surname>Girvin</surname>
            <given-names>R M</given-names>
          </name>
          <name>
            <surname>McNair</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Skuce</surname>
            <given-names>R A</given-names>
          </name>
          <name>
            <surname>Bryson</surname>
            <given-names>D G</given-names>
          </name>
          <name>
            <surname>Pollock</surname>
            <given-names/>
          </name>
          <article-title>Influence of pathological progression on the balance between cellular and humoral immune responses in bovine tuberculosis</article-title>
          <date>
            <year>2005</year>
          </date>
          <source>Immunology</source>
          <volume>114</volume>
          <fpage>101</fpage>
          <lpage>11</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844541444">
        <label>41.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>F</surname>
            <given-names>C Blanco</given-names>
          </name>
          <name>
            <surname>Bigi</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>A Soria</given-names>
          </name>
          <article-title>Identification of potential biomarkers of disease progression in bovine tuberculosis</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>Vet Immunol Immunopathol</source>
          <volume>160</volume>
          <fpage>177</fpage>
          <lpage>183</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1844502620">
        <label>42.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>P Sheridan</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>A Browne</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>B Doyle</given-names>
          </name>
          <name>
            <surname>Fitzsimons</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>McGill</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Gormley</surname>
            <given-names>E</given-names>
          </name>
          <article-title>IL-10 suppression of IFN-γresponses in tuberculin-stimulated whole blood from Mycobacterium bovis infected cattle. Vet Immunol Immunopathol</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>189</volume>
          <fpage>36</fpage>
          <lpage>42</lpage>
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>
